Details for gene: FAM161A


cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; cilium : A specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface and of some cytoplasmic parts. Each cilium is largely bounded by an extrusion of the cytoplasmic (plasma) membrane, and contains a regular longitudinal array of microtubules, anchored to a basal body. ; identical protein binding : Interacting selectively and non-covalently with an identical protein or proteins. ; cytoskeleton : Any of the various filamentous elements that form the internal framework of cells, and typically remain after treatment of the cells with mild detergent to remove membrane constituents and soluble components of the cytoplasm. The term embraces intermediate filaments, microfilaments, microtubules, the microtrabecular lattice, and other structures characterized by a polymeric filamentous nature and long-range order within the cell. The various elements of the cytoskeleton not only serve in the maintenance of cellular shape but also have roles in other cellular functions, including cellular movement, cell division, endocytosis, and movement of organelles. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; cilium assembly : The assembly of a cilium, a specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface. Each cilium is bounded by an extrusion of the cytoplasmic membrane, and contains a regular longitudinal array of microtubules, anchored basally in a centriole. ; cell projection organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of a prolongation or process extending from a cell, e.g. a flagellum or axon. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; microtubule binding : Interacting selectively and non-covalently with microtubules, filaments composed of tubulin monomers. ; centrosome : A structure comprised of a core structure (in most organisms, a pair of centrioles) and peripheral material from which a microtubule-based structure, such as a spindle apparatus, is organized. Centrosomes occur close to the nucleus during interphase in many eukaryotic cells, though in animal cells it changes continually during the cell-division cycle. ; photoreceptor inner segment : The inner segment of a vertebrate photoreceptor containing mitochondria, ribosomes and membranes where opsin molecules are assembled and passed to be part of the outer segment discs. ; ciliary basal body : A membrane-tethered, short cylindrical array of microtubules and associated proteins found at the base of a eukaryotic cilium (also called flagellum) that is similar in structure to a centriole and derives from it. The cilium basal body is the site of assembly and remodelling of the cilium and serves as a nucleation site for axoneme growth. As well as anchoring the cilium, it is thought to provide a selective gateway regulating the entry of ciliary proteins and vesicles by intraflagellar transport. ; mitotic spindle : A spindle that forms as part of mitosis. Mitotic and meiotic spindles contain distinctive complements of proteins associated with microtubules. ; spindle microtubule : Any microtubule that is part of a mitotic or meiotic spindle; anchored at one spindle pole. ; positive regulation of protein acetylation : Any process that activates or increases the frequency, rate or extent of protein acetylation. ; mitotic spindle pole : Either of the ends of a mitotic spindle, a spindle that forms as part of mitosis, where spindle microtubules are organized; usually contains a microtubule organizing center and accessory molecules, spindle microtubules and astral microtubules. ; photoreceptor connecting cilium : The portion of the photoreceptor cell cilium linking the photoreceptor inner and outer segments. It's considered to be equivalent to the ciliary transition zone. ; cilium organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of a cilium, a specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface. Each cilium is bounded by an extrusion of the cytoplasmic membrane, and contains a regular longitudinal array of microtubules, anchored basally in a centriole. ; astral microtubule : Any of the spindle microtubules that radiate in all directions from the spindle poles and are thought to contribute to the forces that separate the poles and position them in relation to the rest of the cell. ;


Symbol
FAM161A
Name
FAM161 centrosomal protein A
Entrez ID
84140
Ensembl ID
ENSG00000170264    (more details)
KEGG ID
hsa:84140    (more details)
OMIM ID
606068
Uniprot ID
Q3B820  
GO ID
hsa:84140    (more details)
Chromosome
14
Strand
-1
Start
21280083
End
21351301
miRNA Interactions
hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-590-3p (RPM: 4.5954) / hsa-miR-148a-3p (RPM: 10339.6222) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-148b-3p (RPM: 970.7614) / hsa-miR-452-5p (RPM: 23.696) / hsa-miR-130b-3p (RPM: 68.2014) / hsa-miR-301a-3p (RPM: 142.8494) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-122-5p (RPM: 0.5028) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-10b-5p (RPM: 14052.6542) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGGCCACCTCCCACCGAGTGGCGAAGCTGGTGGCCTCCAGTCTCCAGACCCCGGTAAATCCCATCACTGGAGCGCGGGTCGCCCAGTACGAACGCGAAGACCCCTTAAAGGCCCTGGCGGCAGCGGAGGCGATCTTGGAGGACGAAGAGGAGGAGAAAGTGGCTCAGCCCGCTGGGGCATCGGCTGATTTGAACACCAGCTTTTCTGGGGTGGATGAACATGCACCGATAAGCTATGAGGACTTTGTGAACTTTCCTGATATTCACCACTCTAATGAGGAGTATTTCAAGAAAGTAGAAGAGTTGAAGGCTGCCCACATAGAAACTATGGCAAAATTAGAGAAAATGTACCAGGATAAATTACATTTAAAGGAAGTTCAGCCAGTGGTCATCAGAGAAGACTCTCTTAGTGACTCTTCCAGATCTGTATCAGAAAAGAACTCCTATCACCCTGTCTCATTAATGACATCATTTTCAGAGCCTGATTTAGGCCAGTCTTCCTCCTTGTATGTGTCCTCCTCTGAAGAGGAGTTACCCAACCTAGAAAAAGAGTATCCTAGGAAAAACAGAATGATGACCTATGCTAAGGAGCTCATCAACAATATGTGGACAGACTTTTGTGTTGAGGATTATATTCGCTGTAAAGATACTGGCTTCCATGCAGCTGAAAAAAGAAGGAAGAAACGAAAAGAATGGGTGCCCACAATTACAGTACCGGAGCCTTTTCAAATGATGATAAGAGAACAGAAGAAAAAAGAAGAGTCCATGAAATCTAAATCAGATATCGAAATGGTACATAAAGCGCTCAAAAAACAAGAAGAGGATCCAGAGTATAAGAAGAAATTCCGAGCCAATCCAGTTCCTGCATCTGTCTTTCTCCCCCTTTACCATGATTTAGTCAAGCAAAAAGAAGAACGGAGAAGGTCTCTGAAGGAGAAAAGCAAAGAAGCTCTTTTGGCCTCACAAAAGCCATTTAAATTTATAGCAAGGGAGGAACAGAAGCGAGCAGCCCGGGAAAAGCAGCTGAGAGACTTTCTTAAGTATAAAAAGAAAACAAATCGATTTAAAGCCAGACCCATTCCTCGATCTACTTATGGTTCAACTACCAATGACAAGTTAAAAGAAGAAGAGCTCTATCGAAACCTTAGGACACAGCTGAGAGCCCAGGAGCATTTACAGAACTCATCTCCTCTGCCTTGTAGGTCAGCTTGTGGATGCAGGAACCCCAGGTGTCCTGAACAGGCTGTAAAGTTGAAGTGTAAACACAAGGTTAGGTGCCCAACTCCTGATTTTGAGGACCTTCCTGAGAGATACCAGAAACACCTCTCAGAACACAAGTCTCCAAAACTCTTAACAGTGTGTAAACCATTTGATCTTCATGCATCTCCACATGCATCTATTAAAAGAGAAAAAATTTTGGCAGACATCGAAGCAGATGAAGAAAATTTAAAAGAAACACGTTGGCCTTATTTGTCTCCAAGGCGTAAGTCACCAGTAAGATGTGCAGGTGTAAACCCTGTGCCTTGTAACTGCAACCCTCCCGTGCCCACGGTATCTTCCAGAGGACGAGAACAAGCCGTAAGAAAGAGCGAAAAGGAAAGGATGAGAGAATACCAACGAGAACTAGAAGAAAGAGAAGAAAAATTAAAAAAGAGGCCACTGCTATTTGAAAGAGTTGCTCAGAAAAATGCAAGAATGGCAGCAGAAAAGCATTATTCTAATACCCTAAAAGCACTAGGAATATCTGATGAGTTTGTTTCAAAGAAAGGCCAAAGTGGAAAAGTACTTGAGTACTTCAACAATCAAGAGACGAAAAGTGTCACTGAAGACAAAGAAAGCTTTAATGAAGAAGAAAAAATAGAAGAAAGAGAGAATGGGGAAGAAAATTATTTTATTGATACCAACAGCCAGGATTCTTACAAGGAAAAAGATGAAGCCAATGAGGAAAGTGAAGAAGAGAAATCTGTTGAAGAATCACACTGA

Back to List