Details for gene: SLC37A3


membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; transmembrane transporter activity : Enables the transfer of a substance, usually a specific substance or a group of related substances, from one side of a membrane to the other. ; transmembrane transport : The process in which a solute is transported across a lipid bilayer, from one side of a membrane to the other. ; endoplasmic reticulum : The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached). ; endoplasmic reticulum membrane : The lipid bilayer surrounding the endoplasmic reticulum. ; carbohydrate transport : The directed movement of carbohydrate into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. Carbohydrates are any of a group of organic compounds based of the general formula Cx(H2O)y. ; integral component of endoplasmic reticulum membrane : The component of the endoplasmic reticulum membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ;


Symbol
SLC37A3
Name
solute carrier family 37 member 3
Entrez ID
84255
Ensembl ID
ENSG00000157800    (more details)
KEGG ID
hsa:84255    (more details)
OMIM ID
619137
Uniprot ID
Q8NCC5  
GO ID
hsa:84255    (more details)
Chromosome
15
Strand
-1
Start
76347904
End
76905444
miRNA Interactions
hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-340-5p (RPM: 285.763) / hsa-miR-106a-5p (RPM: 7.9736) / hsa-miR-380-3p (RPM: 1.6668) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-92a-3p (RPM: 16961.15) / hsa-miR-92b-3p (RPM: 8345.0264) / hsa-miR-3922-5p (RPM: 0.0154) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-let-7f-5p (RPM: 17066.6836) / hsa-let-7c-5p (RPM: 4028.6728) / hsa-miR-582-3p (RPM: 12.5308) / hsa-miR-148b-3p (RPM: 970.7614) / hsa-let-7i-5p (RPM: 2025.2084) / hsa-miR-98-5p (RPM: 1660.0964) / hsa-let-7g-5p (RPM: 3559.4376) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-miR-32-5p (RPM: 14.5562) / hsa-miR-1305 (RPM: 0.128) / hsa-miR-136-5p (RPM: 38.7962) / hsa-miR-766-3p (RPM: 5.2956) / hsa-miR-181d-5p (RPM: 168.2728) / hsa-miR-181b-5p (RPM: 3069.8278) / hsa-miR-181c-5p (RPM: 1285.07) / hsa-miR-181a-5p (RPM: 52364.6344) / hsa-miR-561-5p (RPM: 7.8542) / hsa-miR-616-5p (RPM: 3.0294) / hsa-miR-548d-5p (RPM: 1.1692) / hsa-miR-548i (RPM: 1.7968) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-548c-5p (RPM: 0.235) / hsa-miR-548b-5p (RPM: 0.2842) / hsa-miR-548y (RPM: 0.046) / hsa-miR-142-3p (RPM: 8.3404) / hsa-miR-548w (RPM: 0.4064) / hsa-miR-376a-5p (RPM: 4.9822) / hsa-miR-25-3p (RPM: 1063.0626) / hsa-miR-421 (RPM: 76.7678) / hsa-miR-224-5p (RPM: 33.3102) / hsa-miR-140-3p (RPM: 779.3088) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-192-5p (RPM: 3146.8498) / hsa-miR-3925-5p (RPM: 0.0038) / hsa-miR-483-3p (RPM: 2.3898) / hsa-miR-6794-3p (RPM: 0.1094) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGGCCTGGCCAAATGTTTTTCAAAGAGGGTCTCTGCTGTCCCAGTTCAGCCATCATCATGTTGTAGTGTTCCTGCTCACTTTCTTCAGTTATTCGTTGCTCCATGCTTCACGAAAAACATTTAGCAATGTCAAAGTCAGTATCTCTGAGCAGTGGACCCCAAGTGCTTTTAACACGTCAGTTGAGCTGCCTGTGGAGATCTGGAGCAGCAACCATTTGTTCCCCAGTGCAGAGAAAGCGACTCTTTTCCTCGGCACACTGGATACCATTTTCCTCTTCTCCTATGCTGTGGGCCTATTCATCAGTGGCATCGTTGGGGATCGGTTGAATTTGCGATGGGTTCTGTCTTTTGGCATGTGCTCTTCTGCATTAGTGGTGTTTGTCTTTGGTGCGCTCACAGAATGGCTGCGTTTCTACAACAAATGGCTGTACTGCTGCCTGTGGATTGTGAACGGCCTGCTGCAGTCCACTGGTTGGCCCTGTGTGGTTGCTGTTATGGGCAACTGGTTTGGGAAAGCCGGACGAGGAGTTGTTTTTGGTCTCTGGAGTGCCTGTGCTTCGGTGGGCAACATTTTGGGAGCGTGCCTAGCTTCTTCTGTTCTTCAGTATGGTTATGAGTATGCCTTTCTGGTGACGGCGTCTGTGCAGTTTGCTGGTGGGATCGTTATCTTCTTTGGACTCCTGGTGTCACCAGAAGAAATTGGTCTCTCGGGTATTGAGGCAGAAGAAAACTTTGAAGAAGACTCACACAGGCCATTAATTAATGGTGGTGAAAATGAAGACGAATATGAGCCGAATTATTCAATCCAAGATGATAGTTCTGTTGCCCAAGTCAAGGCGATAAGCTTCTACCAGGCATGTTGCCTTCCTGGAGTCATACCGTACTCACTGGCCTACGCCTGCTTGAAGTTAGTGAATTACTCCTTCTTCTTCTGGCTCCCCTTTTATCTGAGTAACAACTTCGGCTGGAAGGAGGCGGAAGCCGACAAGCTGTCCATTTGGTACGACGTTGGAGGGATCATAGGTGGAACTTTGCAAGGCTTCATCTCTGATGTACTACAGAAGAGAGCGCCGGTTCTTGCCCTGAGTCTGCTTCTGGCAGTTGGGTCCCTCATCGGGTATAGTCGTTCTCCAAATGATAAGTCCATCAATGCCCTTCTGATGACTGTTACAGGATTTTTTATTGGTGGACCTTCTAATATGATTAGTTCTGCTATTTCTGCGGACTTGGGTCGCCAGGAGCTCATCCAAAGGAGCAGTGAAGCTTTGGCCACTGTCACAGGAATTGTGGATGGTTCGGGGAGCATTGGAGCTGCAGTGGGCCAGTATTTAGTGTCTCTGATCCGGGACAAGCTAGGATGGATGTGGGTTTTCTACTTTTTCATTCTCATGACAAGTTGTACAATTGTGTTTATCTCGCCATTAATAGTGAGGGAAATATTCTCTCTCGTGCTAAGGAGACAGGCTCACATATTGAGGGAGTGA

Back to List