Details for gene: CDHR1


plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; calcium ion binding : Interacting selectively and non-covalently with calcium ions (Ca2+). ; homophilic cell adhesion via plasma membrane adhesion molecules : The attachment of a plasma membrane adhesion molecule in one cell to an identical molecule in an adjacent cell. ; cell adhesion : The attachment of a cell, either to another cell or to an underlying substrate such as the extracellular matrix, via cell adhesion molecules. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; integral component of plasma membrane : The component of the plasma membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; molecular_function : A molecular process that can be carried out by the action of a single macromolecular machine, usually via direct physical interactions with other molecular entities. Function in this sense denotes an action, or activity, that a gene product (or a complex) performs. These actions are described from two distinct but related perspectives: (1) biochemical activity, and (2) role as a component in a larger system/process. ; cellular_component : A location, relative to cellular compartments and structures, occupied by a macromolecular machine when it carries out a molecular function. There are two ways in which the gene ontology describes locations of gene products: (1) relative to cellular structures (e.g., cytoplasmic side of plasma membrane) or compartments (e.g., mitochondrion), and (2) the stable macromolecular complexes of which they are parts (e.g., the ribosome). ; cellular process : Any process that is carried out at the cellular level, but not necessarily restricted to a single cell. For example, cell communication occurs among more than one cell, but occurs at the cellular level. ; photoreceptor cell maintenance : Any process preventing the degeneration of the photoreceptor, a specialized cell type that is sensitive to light. ; photoreceptor outer segment membrane : The membrane surrounding the outer segment of a vertebrate photoreceptor. ; photoreceptor cell outer segment organization : A process that is carried out at the cellular level and results in the assembly, arrangement of constituent parts, or disassembly of the outer segment of a photoreceptor cell, a sensory cell that reacts to the presence of light. The outer segment of the photoreceptor cell contains the light-absorbing materials. ; photoreceptor cell morphogenesis : The process in which the structures of a photoreceptor cell are generated and organized. This process occurs while the initially relatively unspecialized cell is acquiring the specialized features of a photoreceptor cell, a sensory cell that reacts to the presence of light. An example of this is found in Drosophila melanogaster. ; cell-cell adhesion : The attachment of one cell to another cell via adhesion molecules. ;


Symbol
CDHR1
Name
cadherin related family member 1
Entrez ID
92211
Ensembl ID
ENSG00000148600    (more details)
KEGG ID
hsa:92211    (more details)
OMIM ID
609502
Uniprot ID
F1T0L2  
GO ID
hsa:92211    (more details)
Chromosome
1
Strand
1
Start
156147366
End
156177752
miRNA Interactions
hsa-miR-212-3p (RPM: 7.7608) / hsa-miR-5691 (RPM: 0.0126) / hsa-miR-3127-3p (RPM: 0.1826) / hsa-miR-3685 (RPM: 0.0826) / hsa-miR-93-5p (RPM: 357.1536) / hsa-miR-3160-5p (RPM: 0.0012) / hsa-miR-3124-3p (RPM: 0.0136) / hsa-miR-384 (RPM: 0.015) / hsa-miR-6885-3p (RPM: 0.043) / hsa-miR-6805-3p (RPM: 0.0046) / hsa-miR-6756-3p (RPM: 0.0192) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGAGGCGCTGCCGGTGGGCCGCCCTGGCCCTGGGGCTGCTGCGCCTCTGCTTGGCTCAGGCCAACTTCGCCCCGCACTTCTTCGACAACGGGGTCGGCAGCACCAACGGAAACATGGCTCTGTTCAGCCTCCCAGAGGACACCCCTGTAGGCTCTCACGTATACACCCTGAATGGGACAGACCCTGAGGGAGACCCCATCTCCTACCACATCAGCTTTGACCCCAGCACTAGAAGCGTCTTTTCTGTTGACCCCACTTTTGGAAACATCACCCTGGTTGAAGAGCTGGACAGAGAGAGGGAAGATGAGATTGAAGCCATCATCAGCATTTCTGATGGCCTGAATCTGGTGGCCGAAAAAGTCGTGATCCTGGTGACCGATGCCAATGATGAGGCGCCCAGGTTCATCCAGGAGCCTTATGTTGCCCTGGTTCCCGAGGACATACCTGCTGGGAGCATCATCTTTAAGGTCCATGCAGTGGACAGGGACACAGGCTCTGGAGGGAGTGTCACCTACTTCCTGCAGAACCTGCACTCCCCATTTGCCGTGGACCGCCACAGCGGTGTGCTGCGCCTCCAGGCTGGGGCCACTCTGGACTACGAGAGGTCCCGGACCCACTACATCACCGTGGTCGCCAAGGATGGCGGTGGGAGGCTTCATGGGGCTGATGTGGTGTTCTCAGCCACCACCACGGTCACGGTCAATGTGGAGGATGTTCAGGACATGGCCCCTGTCTTCGTGGGCACACCCTACTATGGCTATGTGTACGAGGACACCCTTCCGGGCTCGGAGGTACTGAAGGTGGTCGCCATGGATGGAGACCGGGGCAAACCCAATCGAATTCTCTACAGCCTTGTAAATGGGAACGATGGAGCCTTTGAAATTAATGAGACATCTGGAGCCATCTCCATCACTCAGAGCCCGGCCCAGCTCCAGAGAGAGGTGTATGAGCTGCATGTACAGGTGACTGAAATGAGCCCTGCGGGGAGCCCAGCTGCCCAGGCCACCGTCCCAGTCACCATCAGGATTGTGGACCTCAACAACCACCCGCCAACATTCTATGGAGAGAGCGGACCCCAAAACAGGTTTGAGCTGTCCATGAATGAGCACCCACCCCAGGGAGAGATCCTGCGGGGCCTCAAGATCACCGTCAATGACTCCGACCAGGGAGCCAATGCCAAATTCAACTTGCAGCTGGTGGGACCCAGGGGCATCTTCCGAGTGGTTCCACAGACAGTCCTGAATGAAGCCCAAGTCACAATCATTGTGGAGAACTCAGCTGCCATTGACTTTGAAAAGTCCAAAGTATTAACCTTCAAGCTCCTGGCTGTTGAAGTGAACACCCCAGAGAAGTTCAGTTCCACAGCGGATGTTGTGATCCAGCTCCTGGACACCAATGACAATGTCCCCAAGTTCGACTCCCTCTACTACGTTGCCAGGATTCCTGAGAACGCCCCAGGGGGCTCCAGCGTGGTGGCTGTCACAGCTGTGGATCCAGATACAGGACCCTGGGGCGAAGTGAAATATTCCACCTATGGGACTGGGGCAGACCTCTTCCTGATCCACCCATCCACTGGGCTTATCTACACCCAGCCCTGGGCTAGCCTGGACGCTGAGGCCACTGCCAGGTACAACTTCTATGTGAAGGCAGAGGACATGGAAGGCAAGTACAGCGTAGCTGAGGTGTTTATCACACTGCTGGATGTCAATGACCACCCCCCTCAGTTTGGAAAGAGCGTTCAGAAGAAGACGATGGTGCTAGGGACCCCAGTGAAAATTGAGGCCATAGACGAGGATGCAGAGGAACCCAACAACCTGGTGGACTATTCCATCACCCATGCAGAGCCCGCCAACGTGTTCGACATCAATTCCCACACGGGGGAGATCTGGCTCAAGAATTCCATCCGCTCCCTGGATGCCCTGCACAACATCACACCTGGAAGGGACTGCCTATGGTCCCTAGAGGTGCAGGCCAAGGACCGGGGCTCCCCATCCTTCAGCACCACAGCCTTACTCAAGATTGACATCACAGATGCTGAGACCCTCTCCCGGAGCCCCATGGCTGCCTTCCTGATACAGACCAAGGACAACCCCATGAAGGCCGTGGGTGTGCTGGCCGGCACCATGGCCACCGTCGTGGCCATCACTGTCCTCATCTCCACCGCCACCTTCTGGCGCAACAAGAAGTCTAACAAGGTCCTGCCAATGCGGCGGGTGCTCCGCAAGCGGCCCAGCCCTGCGCCCCGCACCATCCGCATTGAGTGGCTCAAGTCCAAGAGCACCAAAGCCGCTACCAAGTTCATGCTCAAAGAGAAACCTCCCAATGAGAACTGTAACAACAACAGCCCAGAAAGCTCTCTGCTCCCGAGAGCTCCGGCTCTCCCTCCACCACCCAGCGTGGCGCCCAGCACTGGCGCAGCCCAGTGGACCGTGCCTACTGTCTCTGGCTCTCTCACTCCGCAGCCGACCCAACCCCCGCCAAAACCCAAAACTATGGGAAGCCCCGTCCAGTCAACTCTGATCTCTGAGCTCAAGCAAAAGTTTGAGAAGAAGAGTGTGCACAACAAGGCTTACTTCTAG

Back to List