Details for gene: REEP6


nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; endoplasmic reticulum : The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached). ; endoplasmic reticulum membrane : The lipid bilayer surrounding the endoplasmic reticulum. ; cytoplasmic vesicle : A vesicle found in the cytoplasm of a cell. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; photoreceptor inner segment : The inner segment of a vertebrate photoreceptor containing mitochondria, ribosomes and membranes where opsin molecules are assembled and passed to be part of the outer segment discs. ; clathrin-coated vesicle membrane : The lipid bilayer surrounding a clathrin-coated vesicle. ; detection of light stimulus involved in visual perception : The series of events involved in visual perception in which a light stimulus is received and converted into a molecular signal. ; endoplasmic reticulum organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of the endoplasmic reticulum. ; regulation of intracellular transport : Any process that modulates the frequency, rate or extent of the directed movement of substances within cells. ;


Symbol
REEP6
Name
receptor accessory protein 6
Entrez ID
92840
Ensembl ID
ENSG00000115255    (more details)
KEGG ID
hsa:92840    (more details)
OMIM ID
609346
Uniprot ID
Q96HR9  
GO ID
hsa:92840    (more details)
Chromosome
7
Strand
1
Start
140293693
End
140404433
miRNA Interactions
hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-191-5p (RPM: 12993.8088) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGGACGGCCTGAGGCAGCGCGTGGAGCACTTCCTGGAGCAAAGGAACCTGGTCACCGAAGTGCTGGGGGCGCTGGAGGCCAAGACCGGGGTGGAGAAGCGGTATCTGGCTGCAGGAGCCGTCACTCTGCTAAGCCTGTATCTGCTGTTCGGCTACGGAGCGTCTCTGCTGTGCAATCTCATCGGATTTGTGTACCCCGCATATGCCTCAATCAAAGCTATCGAGAGCCCAAGCAAGGACGACGACACTGTGTGGCTCACCTACTGGGTGGTGTACGCCCTGTTTGGGCTGGCCGAGTTCTTCAGCGATCTACTCCTGTCCTGGTTCCCTTTCTACTACGTGGGCAAGTGCGCCTTCCTGTTGTTCTGCATGGCTCCCAGGCCCTGGAACGGGGCTCTCATGCTGTATCAGCGCGTCGTGCGTCCGCTGTTCCTAAGGCACCACGGGGCCGTAGACAGAATCATGAACGACCTCAGCGGGCGAGCCCTGGACGCGGCGGCCGGAATAACCAGGAACGTCTTGCAGGTCCTGGCCCGTAGCCGGGCAGGCATCACCCCGGTGGCTGTGGCCGGGCCCTCCACTCCCCTGGAAGCTGACCTCAAGCCAAGCCAGACCCCGCAGCCGAAGGACAAGTGA

Back to List