Details for gene: TTC8


BBSome : A ciliary protein complex involved in cilium biogenesis. It consists of at least seven Bardet-Biedl syndrome (BBS) proteins and BBIP10. It moves in association with IFT trains through cilia (likely as an IFT-A/B adaptor or cargo), and is required for the integrity of IFT-A and IFT-B. ; non-motile cilium assembly : The aggregation, arrangement and bonding together of a set of components to form a non-motile cilium. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; protein transport : The directed movement of proteins into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; cilium : A specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface and of some cytoplasmic parts. Each cilium is largely bounded by an extrusion of the cytoplasmic (plasma) membrane, and contains a regular longitudinal array of microtubules, anchored to a basal body. ; cytoskeleton : Any of the various filamentous elements that form the internal framework of cells, and typically remain after treatment of the cells with mild detergent to remove membrane constituents and soluble components of the cytoplasm. The term embraces intermediate filaments, microfilaments, microtubules, the microtrabecular lattice, and other structures characterized by a polymeric filamentous nature and long-range order within the cell. The various elements of the cytoskeleton not only serve in the maintenance of cellular shape but also have roles in other cellular functions, including cellular movement, cell division, endocytosis, and movement of organelles. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; cell projection organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of a prolongation or process extending from a cell, e.g. a flagellum or axon. ; ciliary membrane : The portion of the plasma membrane surrounding a cilium. ; microtubule organizing center : An intracellular structure that can catalyze gamma-tubulin-dependent microtubule nucleation and that can anchor microtubules by interacting with their minus ends, plus ends or sides. ; ciliary basal body : A membrane-tethered, short cylindrical array of microtubules and associated proteins found at the base of a eukaryotic cilium (also called flagellum) that is similar in structure to a centriole and derives from it. The cilium basal body is the site of assembly and remodelling of the cilium and serves as a nucleation site for axoneme growth. As well as anchoring the cilium, it is thought to provide a selective gateway regulating the entry of ciliary proteins and vesicles by intraflagellar transport. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; non-motile cilium : A cilium which may have a variable array of axonemal microtubules but does not contain molecular motors. ; centrosome : A structure comprised of a core structure (in most organisms, a pair of centrioles) and peripheral material from which a microtubule-based structure, such as a spindle apparatus, is organized. Centrosomes occur close to the nucleus during interphase in many eukaryotic cells, though in animal cells it changes continually during the cell-division cycle. ; RNA polymerase II-specific DNA-binding transcription factor binding : Interacting selectively and non-covalently with a sequence-specific DNA binding RNA polymerase II transcription factor, any of the factors that interact selectively and non-covalently with a specific DNA sequence in order to modulate transcription. ; cilium assembly : The assembly of a cilium, a specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface. Each cilium is bounded by an extrusion of the cytoplasmic membrane, and contains a regular longitudinal array of microtubules, anchored basally in a centriole. ; establishment of planar polarity : Coordinated organization of groups of cells in the plane of an epithelium, such that they all orient to similar coordinates. ; axon guidance : The chemotaxis process that directs the migration of an axon growth cone to a specific target site in response to a combination of attractive and repulsive cues. ; sensory perception of smell : The series of events required for an organism to receive an olfactory stimulus, convert it to a molecular signal, and recognize and characterize the signal. Olfaction involves the detection of chemical composition of an organism's ambient medium by chemoreceptors. This is a neurological process. ; olfactory bulb development : The progression of the olfactory bulb over time from its initial formation until its mature state. The olfactory bulb coordinates neuronal signaling involved in the perception of smell. It receives input from the sensory neurons and outputs to the olfactory cortex. ; regulation of protein localization : Any process that modulates the frequency, rate or extent of any process in which a protein is transported to, or maintained in, a specific location. ; negative regulation of GTPase activity : Any process that stops or reduces the rate of GTP hydrolysis by a GTPase. ; multicellular organism growth : The increase in size or mass of an entire multicellular organism, as opposed to cell growth. ; establishment of epithelial cell apical/basal polarity : The specification and formation of the apicobasal polarity of an epithelial cell. ; fat cell differentiation : The process in which a relatively unspecialized cell acquires specialized features of an adipocyte, an animal connective tissue cell specialized for the synthesis and storage of fat. ; establishment of anatomical structure orientation : The process that determines the orientation of an anatomical structure with reference to an axis. ; sensory processing : Any neural process required for an organism to sense and interpret the dimensions of a sensory experience: modality, location, intensity and affect. ; regulation of stress fiber assembly : Any process that modulates the frequency, rate or extent of the assembly of a stress fiber, a bundle of microfilaments and other proteins found in fibroblasts. ; inner ear receptor cell stereocilium organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of a stereocilium. A stereocilium is an actin-based protrusion from the apical surface of inner ear receptor cells. ; camera-type eye photoreceptor cell differentiation : The process in which a relatively unspecialized cell acquires the specialized features of a photoreceptor cell in a camera-type eye. ; renal tubule development : The progression of the renal tubule over time from its formation to the mature form. A renal tubule is a tube that filters, re-absorbs and secretes substances to rid an organism of waste and to play a role in fluid homeostasis. ; protein localization to plasma membrane : A process in which a protein is transported to, or maintained in, a specific location in the plasma membrane. ; multi-ciliated epithelial cell differentiation : The process in which a relatively unspecialized cell acquires the specialized features of a multi-ciliated epithelial cell. ; photoreceptor connecting cilium : The portion of the photoreceptor cell cilium linking the photoreceptor inner and outer segments. It's considered to be equivalent to the ciliary transition zone. ;


Symbol
TTC8
Name
tetratricopeptide repeat domain 8
Entrez ID
123016
Ensembl ID
ENSG00000165533    (more details)
KEGG ID
hsa:123016    (more details)
OMIM ID
608132
Uniprot ID
A0A0C4DGX9  
GO ID
hsa:123016    (more details)
Chromosome
3
Strand
1
Start
170459548
End
170586075
miRNA Interactions
hsa-miR-30c-5p (RPM: 3890.0396) / hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-548at-5p (RPM: 0.3546) / hsa-miR-30d-5p (RPM: 9562.1366) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-4795-3p (RPM: 0.0626) / hsa-miR-30e-5p (RPM: 2305.0396) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-126-5p (RPM: 3089.0568) / hsa-miR-340-5p (RPM: 285.763) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-30b-5p (RPM: 1466.5144) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-200c-3p (RPM: 348.3196) / hsa-miR-369-3p (RPM: 7.3414) / hsa-miR-200b-3p (RPM: 566.8348) / hsa-miR-486-5p (RPM: 3314.1068) / hsa-miR-520f-3p (RPM: 0.0042) / hsa-miR-373-3p (RPM: 0.0958) / hsa-miR-374b-5p (RPM: 72.7188) / hsa-miR-656-3p (RPM: 3.3332) / hsa-miR-142-5p (RPM: 245.4844) / hsa-miR-138-2-3p (RPM: 0.1862) / hsa-miR-181a-5p (RPM: 52364.6344) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-4524a-3p (RPM: 0.2608) / hsa-miR-1185-2-3p (RPM: 0.191) / hsa-miR-197-3p (RPM: 347.3274) / hsa-miR-605-5p (RPM: 0.3176) / hsa-miR-1185-1-3p (RPM: 1.5496) / hsa-miR-4742-3p (RPM: 0.5414) / hsa-miR-1294 (RPM: 0.9458) / hsa-miR-561-3p (RPM: 0.023) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-125a-3p (RPM: 24.5112) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
BBSome-mediated cargo-targeting to cilium /
Sequence
ATGAGCTCGGAGATGGAGCCGCTGCTCCTGGCCTGGAGCTATTTTAGGCGCAGGAAGTTCCAGCTCTGCGCCGATCTATGCACGCAGATGCTGGAGAAGTCCCCTTATGACCAGGCAGCTTGGATCTTAAAAGCAAGAGCGCTAACAGAAATGGTATACATAGATGAAATTGATGTAGATCAGGAAGGAATTGCAGAAATGATGCTGGATGAAAATGCTATAGCTCAAGTTCCACGCCCTGGAACGTCTTTGAAACTCCCTGGAACTAATCAGACAGGAGGGCCTAGCCAGGCCGTTAGGCCAATCACACAAGCTGGAAGACCCATTACAGGTTTCCTCAGGCCCAGCACGCAGAGTGGAAGGCCAGGCACTATGGAACAGGCTATCAGAACACCCAGAACCGCCTACACAGCCCGCCCTATCACCAGCTCCTCCGGAAGATTTGTCAGGCTGGGAACGGCTTCCATGCTTACAAGTCCTGATGGACCATTTATAAATTTATCTAGGCTGAATTTAACAAAGTATTCCCAGAAACCTAAGTTGGCAAAGGCTTTGTTTGAGTATATCTTTCATCATGAAAATGATGTTAAGACTATTCATCTTGAAGATGTAGTTCTACATCTTGGAATTTACCCATTCTTATTGAGGAATAAAAATCACATTGAAAAAAATGCTTTGGATCTGGCTGCCCTCTCCACAGAACATTCTCAGTACAAGGACTGGTGGTGGAAAGTACAGATTGGAAAATGTTACTACAGGTTGGGAATGTATCGTGAAGCAGAAAAACAGTTTAAATCAGCCCTGAAGCAGCAGGAAATGGTAGATACATTTCTGTACTTGGCAAAAGTTTATGTCTCATTGGATCAACCTGTGACTGCTTTAAATCTTTTCAAACAAGGCTTAGATAAGTTTCCAGGAGAAGTAACCCTGCTCTGTGGAATTGCAAGAATCTATGAGGAAATGAACAATATGTCATCAGCAGCAGAATATTACAAAGAAGTTTTGAAACAAGACAATACTCATGTGGAAGCCATCGCATGCATTGGAAGCAACCACTTCTATTCTGATCAGCCAGAAATAGCTCTCCGGTTTTACAGGCGGCTGCTGCAGATGGGCATTTATAACGGCCAGCTTTTTAACAATCTGGGGCTGTGTTGCTTCTATGCCCAGCAGTATGATATGACTCTGACCTCATTTGAACGTGCCCTTTCTTTGGCTGAAAATGAAGAAGAGGCAGCTGATGTCTGGTACAACTTGGGACATGTAGCTGTGGGAATAGGAGATACAAATTTGGCCCATCAGTGCTTCAGGCTGGCTCTGGTCAACAACAACAACCACGCCGAGGCCTACAACAACCTGGCTGTGCTGGAGATGCGGAAGGGCCACGTTGAACAGGCAAGGGCACTATTACAAACTGCATCATCATTAGCACCCCATATGTATGAACCGCATTTTAATTTTGCAACAATCTCTGATAAGATTGGAGATCTGCAGAGAAGCTATGTTGCTGCGCAGAAGTCTGAAGCAGCATTTCCAGACCATGTGGACACACAACATTTAATTAAACAATTAAGGCAGCATTTTGCTATGCTCTGA

Back to List