Details for gene: ZNF513


nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; DNA binding : Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid). ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; transcription cis-regulatory region binding : Interacting selectively and non-covalently with a specific sequence of DNA that is part of a regulatory region that controls transcription of that section of the DNA. The transcribed region might be described as a gene, cistron, or operon. ; regulation of gene expression : Any process that modulates the frequency, rate or extent of gene expression. Gene expression is the process in which a gene's coding sequence is converted into a mature gene product or products (proteins or RNA). This includes the production of an RNA transcript as well as any processing to produce a mature RNA product or an mRNA or circRNA (for protein-coding genes) and the translation of that mRNA or circRNA into protein. Protein maturation is included when required to form an active form of a product from an inactive precursor form. ; positive regulation of transcription by RNA polymerase II : Any process that activates or increases the frequency, rate or extent of transcription from an RNA polymerase II promoter. ; retina development in camera-type eye : The process whose specific outcome is the progression of the retina over time, from its formation to the mature structure. The retina is the innermost layer or coating at the back of the eyeball, which is sensitive to light and in which the optic nerve terminates. ;


Symbol
ZNF513
Name
zinc finger protein 513
Entrez ID
130557
Ensembl ID
ENSG00000163795    (more details)
KEGG ID
hsa:130557    (more details)
OMIM ID
613598
Uniprot ID
Q8N8E2  
GO ID
hsa:130557    (more details)
Chromosome
14
Strand
-1
Start
88384924
End
88470350
miRNA Interactions
hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-340-5p (RPM: 285.763) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-376a-5p (RPM: 4.9822) / hsa-miR-27a-5p (RPM: 7.3838) / hsa-miR-191-5p (RPM: 12993.8088) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGCCCCGAAGGAAGCAAAGCCACCCGCAGCCCGTGAAATGCGAGGGGGTCAAAGTGGATACTGAAGACTCCCTCGACGAAGGACCCGGGGCCCTGGTATTGGAGAGTGATTTGCTACTAGGCCAGGATCTGGAGTTTGAGGAGGAAGAGGAAGAGGAGGAAGGCGACGGCAACAGTGACCAGCTCATGGGCTTCGAGAGAGACTCGGAAGGAGACTCTCTGGGGGCCAGGCCTGGGCTTCCCTATGGGCTGAGCGACGATGAGTCTGGGGGCGGCCGGGCACTAAGTGCGGAGAGTGAAGTTGAGGAGCCAGCCAGGGGTCCAGGGGAGGCCAGGGGTGAGAGGCCAGGCCCAGCCTGCCAGCTGTGTGGGGGGCCGACAGGTGAGGGGCCGTGTTGTGGGGCAGGAGGGCCGGGTGGGGGGCCCCTGCTGCCCCCACGGCTACTGTACTCATGCCGCCTCTGCACCTTCGTGTCCCACTACTCGAGCCACCTGAAGCGGCACATGCAGACACACAGCGGAGAGAAGCCGTTCCGCTGTGGCCGCTGCCCCTACGCCTCAGCCCAGCTCGTCAACCTGACACGACATACCCGCACCCACACTGGCGAGAAGCCCTACCGCTGTCCCCACTGCCCCTTTGCCTGCAGCAGCCTGGGCAACCTGAGGCGGCATCAGCGTACCCACGCAGGGCCCCCCACTCCTCCCTGCCCGACCTGTGGCTTCCGCTGCTGTACTCCACGACCAGCCCGGCCTCCCAGTCCCACAGAGCAGGAGGGGGCGGTGCCCCGGCGACCTGAAGATGCTCTGCTCCTTCCAGATTTGAGCCTCCATGTGCCACCAGGTGGTGCCAGTTTCCTGCCAGACTGTGGGCAGCTGCGGGGTGAAGGGGAGGGCCTCTGCGGGACTGGATCAGAACCACTGCCAGAGCTGCTATTCCCTTGGACCTGCCGGGGCTGTGGACAAGAGCTGGAGGAGGGTGAGGGTAGTCGGCTGGGAGCTGCCATGTGTGGGCGCTGCATGCGAGGAGAGGCTGGAGGGGGTGCCAGTGGGGGGCCCCAGGGCCCCAGTGACAAAGGCTTTGCCTGTAGCCTCTGCCCCTTTGCCACTCACTATCCCAACCACCTGGCCCGGCACATGAAGACACACAGTGGTGAGAAGCCCTTCCGCTGCGCCCGCTGTCCTTATGCCTCTGCTCATCTGGATAACCTGAAACGGCACCAGCGCGTCCATACAGGAGAGAAGCCCTACAAGTGCCCCCTCTGCCCTTATGCCTGTGGCAATCTGGCCAACCTCAAGCGTCATGGTCGCATCCACTCTGGTGACAAACCTTTTCGGTGTAGCCTTTGCAACTACAGCTGCAACCAGAGCATGAACCTCAAACGTCACATGCTGCGGCACACAGGCGAGAAGCCCTTCCGCTGTGCCACCTGCGCCTATACCACGGGCCACTGGGACAACTACAAGCGCCACCAGAAGGTGCATGGCCACGGTGGGGCAGGAGGGCCTGGTCTCTCTGCCTCTGAGGGCTGGGCCCCACCTCATAGCCCACCCTCTGTTTTGAGCTCTCGGGGCCCACCAGCCCTGGGGACTGCTGGCAGCCGGGCTGTCCACACAGACTCATCCTGA

Back to List