Details for gene: HGSNAT


lysosomal membrane : The lipid bilayer surrounding the lysosome and separating its contents from the cell cytoplasm. ; heparan-alpha-glucosaminide N-acetyltransferase activity : Catalysis of the reaction: acetyl-CoA + heparan alpha-D-glucosaminide = CoA + heparan N-acetyl-alpha-D-glucosaminide. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; transferase activity : Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2. ; acyltransferase activity : Catalysis of the transfer of an acyl group from one compound (donor) to another (acceptor). ; lysosome : A small lytic vacuole that has cell cycle-independent morphology and is found in most animal cells and that contains a variety of hydrolases, most of which have their maximal activities in the pH range 5-6. The contained enzymes display latency if properly isolated. About 40 different lysosomal hydrolases are known and lysosomes have a great variety of morphologies and functions. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; specific granule membrane : The lipid bilayer surrounding a specific granule, a granule with a membranous, tubular internal structure, found primarily in mature neutrophil cells. Most are released into the extracellular fluid. Specific granules contain lactoferrin, lysozyme, vitamin B12 binding protein and elastase. ; tertiary granule membrane : The lipid bilayer surrounding a tertiary granule. ; protein complex oligomerization : The process of creating protein oligomers, compounds composed of a small number, usually between three and ten, of component monomers; protein oligomers may be composed of different or identical monomers. Oligomers may be formed by the polymerization of a number of monomers or the depolymerization of a large protein polymer. ; lysosomal transport : The directed movement of substances into, out of or within a lysosome. ;


Symbol
HGSNAT
Name
heparan-alpha-glucosaminide N-acetyltransferase
Entrez ID
138050
Ensembl ID
ENSG00000165102    (more details)
KEGG ID
hsa:138050    (more details)
OMIM ID
252930
Uniprot ID
Q68CP4  
GO ID
hsa:138050    (more details)
Chromosome
14
Strand
1
Start
88824153
End
88881078
miRNA Interactions
hsa-miR-15a-5p (RPM: 139.425) / hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-133a-3p (RPM: 411.6588) / hsa-miR-15b-5p (RPM: 133.5752) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-27b-3p (RPM: 22876.2392) / hsa-miR-506-3p (RPM: 0.6452) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-138-5p (RPM: 67.2828) / hsa-miR-96-5p (RPM: 1417.2834) / hsa-miR-130a-3p (RPM: 723.372) / hsa-miR-452-5p (RPM: 23.696) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-148a-5p (RPM: 130.608) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-21-5p (RPM: 5494.851) / hsa-miR-22-3p (RPM: 26348.475) / hsa-miR-181b-5p (RPM: 3069.8278) / hsa-miR-449b-5p (RPM: 1.2108) / hsa-miR-21-3p (RPM: 238.3548) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-642b-3p (RPM: 0.0292) / hsa-miR-615-3p (RPM: 0.1424) / hsa-miR-9-3p (RPM: 123.624) / hsa-miR-1225-5p (RPM: 0.0114) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-483-5p (RPM: 0.9526) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Metabolic pathways / Lysosome / Glycosaminoglycan degradation /
Sequence
ATGAGCGGGGCGGGCAGGGCGCTGGCCGCGCTGCTGCTGGCCGCGTCCGTGCTGAGCGCCGCGCTGCTGGCCCCCGGCGGCTCTTCGGGGCGCGATGCCCAGGCCGCGCCGCCACGAGACTTAGACAAAAAAAGACATGCAGAGCTGAAGATGGATCAGGCTTTGCTACTCATCCATAATGAACTTCTCTGGACCAACTTGACCGTCTACTGGAAATCTGAATGCTGTTATCACTGCTTGTTTCAGGTTCTGGTAAACGTTCCTCAGAGTCCAAAAGCAGGGAAGCCTAGTGCTGCAGCTGCCTCTGTCAGCACCCAGCACGGATCTATCCTGCAGCTGAACGACACCTTGGAAGAGAAAGAAGTTTGTAGGTTGGAATACAGATTTGGAGAATTTGGAAACTATTCTCTCTTGGTAAAGAACATCCATAATGGAGTTAGTGAAATTGCCTGTGACCTGGCTGTGAACGAGGATCCAGTTGATAGTAACCTTCCTGTGAGCATTGCATTCCTTATTGGTCTTGCTGTCATCATTGTGATATCCTTTCTGAGGCTCTTGTTGAGTTTGGATGACTTTAACAATTGGATTTCTAAAGCCATAAGTTCTCGAGAAACTGATCGCCTCATCAATTCTGAGCTGGGATCTCCCAGCAGGACAGACCCTCTCGATGGTGATGTTCAGCCAGCAACGTGGCGTCTATCTGCCCTGCCGCCCCGCCTCCGCAGCGTGGACACCTTCAGGGGGATTGCTCTTATACTCATGGTCTTTGTCAATTATGGAGGAGGAAAATATTGGTACTTCAAACATGCAAGTTGGAATGGGCTGACAGTGGCTGACCTCGTGTTCCCGTGGTTTGTATTTATTATGGGATCTTCCATTTTTCTATCGATGACTTCTATACTGCAACGGGGGTGTTCAAAATTCAGATTGCTGGGGAAGATTGCATGGAGGAGTTTCCTGTTAATCTGCATAGGAATTATCATTGTGAATCCCAATTATTGCCTTGGTCCATTGTCTTGGGACAAGGTGCGCATTCCTGGTGTGCTGCAGCGATTGGGAGTGACATACTTTGTGGTTGCTGTGTTGGAGCTCCTCTTTGCTAAACCTGTGCCTGAACATTGTGCCTCGGAGAGGAGCTGCCTTTCTCTTCGAGACATCACGTCCAGCTGGCCCCAGTGGCTGCTCATCCTGGTGCTGGAAGGCCTGTGGCTGGGCTTGACATTCCTCCTGCCAGTCCCTGGGTGCCCTACTGGTTATCTTGGTCCTGGGGGCATTGGAGATTTTGGCAAGTATCCAAATTGCACTGGAGGAGCTGCAGGCTACATCGACCGCCTGCTGCTGGGAGACGATCACCTTTACCAGCACCCATCTTCTGCTGTACTTTACCACACCGAGGTGGCCTATGACCCCGAGGGCATCCTGGGCACCATCAACTCCATCGTGATGGCCTTTTTAGGAGTTCAGGCAGGAAAAATACTATTGTATTACAAGGCTCGGACCAAAGACATCCTGATTCGATTCACTGCTTGGTGTTGTATTCTTGGGCTCATTTCTGTTGCTCTGACGAAGGTTTCTGAAAATGAAGGCTTTATTCCAGTAAACAAAAATCTCTGGTCCCTTTCGTATGTCACTACGCTCAGTTCTTTTGCCTTCTTCATCCTGCTGGTCCTGTACCCAGTTGTGGATGTGAAGGGGCTGTGGACAGGAACCCCATTCTTTTATCCAGGAATGAATTCCATTCTGGTATATGTCGGCCACGAGGTGTTTGAGAACTACTTCCCCTTTCAGTGGAAGCTGAAGGACAACCAGTCCCACAAGGAGCACCTGACTCAGAACATCGTCGCCACTGCCCTCTGGGTGCTCATTGCCTACATCCTCTATAGAAAGAAGATTTTTTGGAAAATCTGA

Back to List