Details for gene: RDH12


oxidoreductase activity : Catalysis of an oxidation-reduction (redox) reaction, a reversible chemical reaction in which the oxidation state of an atom or atoms within a molecule is altered. One substrate acts as a hydrogen or electron donor and becomes oxidized, while the other acts as hydrogen or electron acceptor and becomes reduced. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; endoplasmic reticulum : The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached). ; endoplasmic reticulum membrane : The lipid bilayer surrounding the endoplasmic reticulum. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; NADP-retinol dehydrogenase activity : Catalysis of the reaction: all-trans-retinol + NADP+ = all-trans-retinal + NADPH + H+. ; retinol metabolic process : The chemical reactions and pathways involving retinol, one of the three compounds that makes up vitamin A. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; photoreceptor inner segment : The inner segment of a vertebrate photoreceptor containing mitochondria, ribosomes and membranes where opsin molecules are assembled and passed to be part of the outer segment discs. ; NAD-retinol dehydrogenase activity : Catalysis of the reaction: retinol + NAD+ = retinal + NADH + H+. ; cellular detoxification of aldehyde : Any process carried out at the cellular level that reduces or removes the toxicity of an aldehyde. These may include transport of aldehydes away from sensitive areas and to compartments or complexes whose purpose is sequestration of the toxic substance. ; photoreceptor cell maintenance : Any process preventing the degeneration of the photoreceptor, a specialized cell type that is sensitive to light. ; retinoid metabolic process : The chemical reactions and pathways involving retinoids, any member of a class of isoprenoids that contain or are derived from four prenyl groups linked head-to-tail. Retinoids include retinol and retinal and structurally similar natural derivatives or synthetic compounds, but need not have vitamin A activity. ; 11-cis-retinol dehydrogenase activity : Catalysis of the reaction: 11-cis-retinol + NADP = 11-cis-retinal + NADPH + H+. ; photoreceptor inner segment membrane : The membrane surrounding the inner segment of a vertebrate photoreceptor. The photoreceptor inner segment contains mitochondria, ribosomes and membranes where opsin molecules are assembled and passed to be part of the outer segment discs. ;


Symbol
RDH12
Name
retinol dehydrogenase 12
Entrez ID
145226
Ensembl ID
ENSG00000139988    (more details)
KEGG ID
hsa:145226    (more details)
OMIM ID
608830
Uniprot ID
A0A0S2Z613  
GO ID
hsa:145226    (more details)
Chromosome
11
Strand
1
Start
46701030
End
46705912
miRNA Interactions
hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-200b-3p (RPM: 566.8348) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Metabolic pathways / Retinol metabolism /
Sequence
ATGCTGGTCACCTTGGGACTGCTCACCTCCTTCTTCTCGTTCCTGTATATGGTAGCTCCATCCATCAGGAAGTTCTTTGCTGGTGGAGTGTGTAGAACAAATGTGCAGCTTCCTGGCAAGGTAGTGGTGATCACTGGCGCCAACACGGGCATTGGCAAGGAGACGGCCAGAGAGCTCGCTAGCCGAGGAGCCCGAGTCTATATTGCCTGCAGAGATGTACTGAAGGGGGAGTCTGCTGCCAGTGAAATCCGAGTGGATACAAAGAACTCCCAGGTGCTGGTGCGGAAATTGGACCTATCCGACACCAAATCTATCCGAGCCTTTGCTGAGGGCTTTCTGGCAGAGGAAAAGCAGCTCCATATTCTGATCAACAATGCGGGAGTAATGATGTGTCCATATTCCAAGACAGCTGATGGCTTTGAAACCCACCTGGGAGTCAACCACCTGGGCCACTTCCTCCTCACCTACCTGCTCCTGGAGCGGCTAAAGGTGTCTGCCCCTGCACGGGTGGTTAATGTGTCCTCGGTGGCTCACCACATTGGCAAGATTCCCTTCCACGACCTCCAGAGCGAGAAGCGCTACAGCAGGGGTTTTGCCTATTGCCACAGCAAGCTGGCCAATGTGCTTTTTACTCGTGAGCTGGCCAAGAGGCTCCAAGGCACCGGGGTCACCACCTACGCAGTGCACCCAGGCGTCGTCCGCTCTGAGCTGGTCCGGCACTCCTCCCTGCTCTGCCTGCTCTGGCGGCTCTTCTCCCCCTTTGTCAAGACGGCACGGGAGGGGGCGCAGACCAGCCTGCACTGCGCCCTGGCTGAGGGCCTGGAGCCCCTGAGTGGCAAGTACTTCAGTGACTGCAAGAGGACCTGGGTGTCTCCAAGGGCCCGAAATAACAAAACAGCTGAGCGCCTATGGAATGTCAGCTGTGAGCTTCTAGGAATCCGGTGGGAGTAG

Back to List