Details for gene: FAM71A


nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ;


Symbol
FAM71A
Name
family with sequence similarity 71 member A
Entrez ID
149647
Ensembl ID
ENSG00000162771    (more details)
KEGG ID
hsa:149647    (more details)
OMIM ID
FALSE
Uniprot ID
B2RCB4  
GO ID
hsa:149647    (more details)
Chromosome
2
Strand
1
Start
27377235
End
27380790
miRNA Interactions
hsa-miR-191-5p (RPM: 12993.8088) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGAATGCTGATTTTCTGCTGCCGTATTATACGGCCCAGAGTGGCTCCAGCATGAGCATGTTCAACACCACCATGGGGAAACTGCAGCGACAACTGTACAAGGGGGAGTACGATATATTCAAGTATGCACCGATATTTGAGAGCGACTTTATCCAGATCACCAAAAGGGGAGAAGTGATTGATGTGCACAACCGTGTCCGTATGGTGACCATGGGCATTGCACGTACCAGCCCCATCCTCCCACTCCCAGATGTCATGCTACTGGCACGACCGGCCACCGGCTGCGAAGAGTATGCTGGACATGGCCAGGCCACCAAGAGAAAAAAACGCAAGGCAGCAAAGAACTTAGAGCTCACCAGGCTTCTGCCCCTGAGGTTTGTACGGATCTCTGTTCAAGACCATGAGAAACAACAGCTGCGCCTGAAGTTCGCCACTGGCAGATCTTGCTATCTGCAATTGTGTCCCGCTCTTGACACACGGGATGACCTCTTTGCCTATTGGGAAAAACTAATTTACCTCTTGCGGCCACCCATGGAGAGTAACAGCAGTACCTGTGGCATTCCAGCTGAAGACATGATGTGGATGCCTGTGTTTCAGGAAGACAGGAGGAGCCTGGGAGCCGTGAACCTTCAAGGAAAGGGGGATCAGGACCAGGTCAGCATCCAAAGCCTCCACATGGTCTCTGAGGTGTGTGGGGCCACCTCTGCTGCTTATGCTGGAGGGGAGGGACTCCAAAATGACTTTAACAAACCCACTAATGTGCTCAATGCATCCATCCCCAAAACATCTACAGAACTTGCTGAGGAGCCAGCAACAGGGGGGATTAAAGAGGCAGCAGCAGCAGGGGCAGCTGCAGGGGCAGCAACAGGCACCGTAGCAGGTGCCTTGAGTGTGGCAGCAGCCAATTCTGCCCCTGGACAGGTGAGCGCAGCCATAGCTGGGGCGGCCACCATCGGTGCAGGAGGAAACAAAGGCAACATGGCCCTTGCAGGCACTGCCAGCATGGCTCCAAACAGCACGAAGGTGGCTGTGGCAGGGGCTGCAGGCAAGTCCTCAGAGCATGTTTCCAGCGCATCCATGAGCCTTTCCCGAGAGGGCAGTGTGAGCCTGGCCATTGCAGGAGTAGTACTGACCAGCAGGACAGCTGCAGAAGCAGACATGGATGCAGCAGCGGGACCTCCCGTCTCCACCCGGCAGAGCAAGAGCAGCCTGAGTGGACAGCATGGAAGGGAGCGAACCCAGGCCAGCGCTGAAGGCTGCAAGGAGGGGAGGGAAAGAAGGGAAAAGGACAGGGCTCTCGGAAGGAGTTCCCATCGCCGCAGGACAGGTGAAAGCCGCCACAAAACAAGGGGAGACAAGATTGCCCAAAAGTCCTCCAGCAGGTCCTCATTCAGCCACAGAGCCAATAGAGATGACAAAAAGGAGAAAGGCTGTGGCAACCCGGGGAGCAGCAGGCACAGGGACTCGCATAAAGGTGTCAGCCACACGCCCATCTCAAAGGAGTCCAGGACCTCTCACAAATCTGGGAGGAGCTTATGGACCACCAGTTCCGGTTCCAGCAAGGGACTTGGCAGGGTCAGCTCTTTCCTGAGGAACGTCAGAGCCAACCTTACTACAAAAGTAGTGGGCACACCACATGGCAGAGATGTGAACGTCATGGCTAAGATGGCGGAGAGGAGCACCAACGTGGCCATCGCCGAGACAGCAGAGGGTGGCCAGGGGCTGGAGACGGTTGGTTCTATGACACCGGACATCATGGAGACAGTGACCTTTGAAGCCCATTAA

Back to List