Details for gene: CCZ1B


vesicle-mediated transport : A cellular transport process in which transported substances are moved in membrane-bounded vesicles; transported substances are enclosed in the vesicle lumen or located in the vesicle membrane. The process begins with a step that directs a substance to the forming vesicle, and includes vesicle budding and coating. Vesicles are then targeted to, and fuse with, an acceptor membrane. ; Mon1-Ccz1 complex : A protein complex that functions as a guanine nucleotide exchange factor (GEF) and converts Rab-GDP to Rab-GTP. In S. cerevisiae, this complex consists of at least Mon1 and Ccz1, and serves as a GEF for the Rab Ypt7p. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; intracellular membrane-bounded organelle : Organized structure of distinctive morphology and function, bounded by a single or double lipid bilayer membrane and occurring within the cell. Includes the nucleus, mitochondria, plastids, vacuoles, and vesicles. Excludes the plasma membrane. ; lysosomal membrane : The lipid bilayer surrounding the lysosome and separating its contents from the cell cytoplasm. ; lysosome : A small lytic vacuole that has cell cycle-independent morphology and is found in most animal cells and that contains a variety of hydrolases, most of which have their maximal activities in the pH range 5-6. The contained enzymes display latency if properly isolated. About 40 different lysosomal hydrolases are known and lysosomes have a great variety of morphologies and functions. ;


Symbol
CCZ1B
Name
CCZ1 homolog B, vacuolar protein trafficking and biogenesis associated
Entrez ID
221960
Ensembl ID
ENSG00000146574    (more details)
KEGG ID
hsa:221960    (more details)
OMIM ID
FALSE
Uniprot ID
P86790  
GO ID
hsa:221960    (more details)
Chromosome
7
Strand
-1
Start
141551278
End
141655244
miRNA Interactions
hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-455-5p (RPM: 19.0882) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-215-5p (RPM: 12.4448) / hsa-miR-192-5p (RPM: 3146.8498) / hsa-miR-100-5p (RPM: 3365.0918) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-218-5p (RPM: 36.775) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGGCTGCAGCGGCGGCCGGGGCCGGGAGCGGGCCCTGGGCGGCCCAGGAGAAGCAGTTCCCGCCGGCGCTGCTGAGTTTCTTCATCTACAACCCGCGCTTCGGGCCGCGCGAAGGACAGGAGGAAAATAAGATTTTATTTTATCATCCAAATGAGGTAGAAAAGAATGAGAAGATTAGAAATGTCGGATTGTGTGAAGCTATTGTACAGTTTACAAGGACATTTAGCCCATCAAAACCTGCAAAATCTTTACATACACAGAAGAACAGACAGTTCTTCAATGAACCAGAAGAAAATTTCTGGATGGTCATGGTTGTTCGGAATCCTATAATTGAAAAACAGAGTAAAGATGGAAAACCAGTTATTGAATATCAAGAGGAGGAGTTGTTGGACAAGGTTTATAGCTCGGTGCTGCGGCAGTGCTACAGCATGTACAAGCTTTTTAATGGTACATTTCTGAAAGCCATGGAAGACGGAGGCGTCAAGCTTCTGAAAGAAAGATTAGAGAAATTCTTCCATCGGTATTTGCAAACGCTACATTTGCAGTCATGTGACCTACTTGACATTTTTGGTGGAATCAGCTTCTTCCCGTTGGATAAAATGACTTATTTGAAAATCCAGTCCTTTATTAATAGAATGGAGGAAAGCCTGAATATAGTCAAATACACTGCTTTTCTCTATAACGATCAGCTCATCTGGAGTGGATTAGAACAAGATGACATGAGAATTTTATACAAATACCTTACCACCTCCCTTTTCCCAAGGCACATCGAACCTGAGTTAGCAGGAAGGGATTCTCCAATAAGAGCAGAAATGCCAGGAAATCTTCAACACTATGGAAGATTTCTTACCGGACCCTTGAACCTCAATGATCCAGATGCAAAATGCAGATTCCCCAAAATTTTTGTAAATACAGATGACACTTATGAAGAGCTCCATTTAATCGTTTATAAGGCCATGAGTGCGGCTGTGTGCTTTATGATCGACGCCTCTGTCCACCCAACGTTGGATTTTTGCCGAAGACTGGACAGCATCGTTGGGCCCCAGCTCACAGTGCTGGCCTCTGACATCTGTGAACAGTTTAACATCAACAAGAGGATGTCTGGGTCTGAGAAAGAACCCCAGTTTAAGTTTATCTACTTCAACCACATGAATCTCGCCGAGAAGAGCACAGTTCACATGAGGAAAACGCCCAGCGTGTCGCTCACTTCCGTGCACCCGGATTTAATGAAGATTCTCGGTGACATCAACAGTGACTTTACCAGAGTGGATGAAGATGAGGAGATCATTGTGAAGGCCATGAGTGATTACTGGGTTGTTGGAAAGAAGTCTGATCGGCGGGAGCTCTATGTTATTTTGAATCAAAAAAATGCAAACCTGATTGAAGTAAATGAAGAGGTCAAGAAACTTTGTGCAACGCAGTTCAACAACATCTTCTTCTTGGATTGA

Back to List