Details for gene: CERKL


kinase activity : Catalysis of the transfer of a phosphate group, usually from ATP, to a substrate molecule. ; NAD+ kinase activity : Catalysis of the reaction: ATP + NAD(+) = ADP + 2 H(+) + NADP(+). ; phosphorylation : The process of introducing a phosphate group into a molecule, usually with the formation of a phosphoric ester, a phosphoric anhydride or a phosphoric amide. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; negative regulation of apoptotic process : Any process that stops, prevents, or reduces the frequency, rate or extent of cell death by apoptotic process. ; endoplasmic reticulum : The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached). ; nucleoplasm : That part of the nuclear content other than the chromosomes or the nucleolus. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; Golgi apparatus : A membrane-bound cytoplasmic organelle of the endomembrane system that further processes the core oligosaccharides (e.g. N-glycans) added to proteins in the endoplasmic reticulum and packages them into membrane-bound vesicles. The Golgi apparatus operates at the intersection of the secretory, lysosomal, and endocytic pathways. ; nucleolus : A small, dense body one or more of which are present in the nucleus of eukaryotic cells. It is rich in RNA and protein, is not bounded by a limiting membrane, and is not seen during mitosis. Its prime function is the transcription of the nucleolar DNA into 45S ribosomal-precursor RNA, the processing of this RNA into 5.8S, 18S, and 28S components of ribosomal RNA, and the association of these components with 5S RNA and proteins synthesized outside the nucleolus. This association results in the formation of ribonucleoprotein precursors; these pass into the cytoplasm and mature into the 40S and 60S subunits of the ribosome. ; lipid phosphorylation : The process of introducing one or more phosphate groups into a lipid, any member of a group of substances soluble in lipid solvents but only sparingly soluble in aqueous solvents. ; lipid kinase activity : Catalysis of the phosphorylation of a simple or complex lipid. ; sphingolipid binding : Interacting selectively and non-covalently with sphingolipids, a class of lipids containing the long-chain amine diol sphingosine or a closely related base (a sphingoid). ; sphingolipid metabolic process : The chemical reactions and pathways involving sphingolipids, any of a class of lipids containing the long-chain amine diol sphingosine or a closely related base (a sphingoid). ; sphingolipid biosynthetic process : The chemical reactions and pathways resulting in the formation of sphingolipids, any of a class of lipids containing the long-chain amine diol sphingosine or a closely related base (a sphingoid). ; photoreceptor outer segment : The outer segment of a vertebrate photoreceptor that contains a stack of membrane discs embedded with photoreceptor proteins. ; photoreceptor inner segment : The inner segment of a vertebrate photoreceptor containing mitochondria, ribosomes and membranes where opsin molecules are assembled and passed to be part of the outer segment discs. ; perinuclear region of cytoplasm : Cytoplasm situated near, or occurring around, the nucleus. ;


Symbol
CERKL
Name
ceramide kinase like
Entrez ID
375298
Ensembl ID
ENSG00000188452    (more details)
KEGG ID
hsa:375298    (more details)
OMIM ID
608380
Uniprot ID
Q49MI3  
GO ID
hsa:375298    (more details)
Chromosome
13
Strand
-1
Start
110148963
End
110307157
miRNA Interactions
hsa-miR-129-1-3p (RPM: 8.647) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-607 (RPM: 0.001) / hsa-miR-4709-3p (RPM: 0.3318) / hsa-miR-676-5p (RPM: 0.0914) / hsa-miR-203a-3p (RPM: 1346.5646) / hsa-miR-4635 (RPM: 0.0156) / hsa-miR-4762-5p (RPM: 0.0998) / hsa-miR-4699-5p (RPM: 0.0134) / hsa-miR-4780 (RPM: 0.2546) / hsa-miR-4433a-3p (RPM: 0.0012) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGCCCTGGAGGAGGCGCAGGAACCGGGTGAGTGCCCTGGAGGGCGGCCGGGAGGAAGAGGCGCCCCCGGAGGCTGCCGCTGTGCCTCCGGCGCTGTTAACGTCCCCGCAGCAGACGGAGGCGGCGGCCGAGCGGATTCTGCTCCGGGGCATCTTCGAGATCGGGAGGGACAGTTGTGACGTGGTGCTGAGCGAGCGAGCACTGCGGTGGCGGCCCATTCAGCCCGAGCGCCCGGCGGGTGATTCTAAGTATGACTTGCTATGTAAAGAAGAATTTATTGAACTCAAAGACATATTCTCTGTGAAACTGAAACGGCGTTGTTCTGTTAAACAGCAGAGAAGTGGTACTTTATTAGGTATCACACTCTTCATCTGCTTGAAAAAGGAACAAAATAAACTAAAGAATTCTACACTTGATCTTATTAATTTAAGTGAAGACCACTGTGACATATGGTTTAGACAGTTCAAGAAAATATTGGCAGGCTTTCCAAACAGACCGAAGTCATTAAAAATACTCCTTAACCCCCAAAGTCACAAAAAAGAAGCTACCCAGGTTTATTATGAGAAGGTTGAACCTCTGTTGAAGCTTGCAGGAATAAAAACTGATGTAACAATAATGGAATATGAAGGGCACGCTCTGTCACTGCTTAAGGAATGTGAACTCCAGGGATTTGATGGTGGGCATCGGAAACCATTGTTCGCAATACATTGGAGTGTACAGAGATTGTTCACTGGCATGCAAACGTTAGAACCAAGTGTTGTCTGTGTTGGTGGAGATGGATCTGCTAGCGAAGTAGCCCATGCTTTGCTTCTGAGAGCTCAGAAGAATGCTGGGATGGAAACAGACCGAATCCTGACTCCTGTCAGAGCACAGCTTCCACTTGGCTTAATACCAGCAGGATCTACCAATGTATTGGCACATTCTCTTCATGGAGTTCCTCATGTGATAACTGCAACATTGCACATTATAATGGGGCATGTACAGCTGGTCGACGTCTGCACCTTCAGCACCGCTGGCAAGCTTCTTCGCTTTGGGTTCTCAGCCATGTTTGGCTTTGGTGGAAGAACTTTGGCTCTGGCAGAAAAATATCGATGGATGTCCCCTAACCAACGGAGAGATTTTGCTGTTGTTAAGGCACTGGCAAAACTTAAGGCAGAAGACTGTGAAATATCATTTTTACCATTTAACAGCTCTGATGATGTGCAAGAAAGGAGGGCACAGGGATCTCCCAAATCTGACTGTAATGATCAATGGCAAATGATCCAGGGTCAGTTCTTGAATGTCAGCATTATGGCAATTCCTTGCCTGTGTTCAGTGGCACCTAGAGGCTTGGCACCTAATACCAGATTAAATAATGGAAGTATGGCTCTTATAATTGCCCGAAACACTTCTCGGCCAGAATTTATAAAACACCTGAAAAGATATGCCAGTGTAAAAAATCAGTTCAATTTTCCATTTGTTGAGACTTACACTGTTGAGGAAGTAAAAGTTCATCCAAGGAATAATACTGGTGGATATAATCCAGAGGAGGAGGAGGATGAAACTGCTTCAGAAAATTGTTTCCCTTGGAATGTAGATGGTGACTTAATGGAAGTTGCATCAGAGGTCCATATTAGATTGCATCCAAGACTTATCAGTCTTTATGGAGGAAGCATGGAAGAAATGATTCCAAAGTAA

Back to List