Details for gene: PCARE


cilium : A specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface and of some cytoplasmic parts. Each cilium is largely bounded by an extrusion of the cytoplasmic (plasma) membrane, and contains a regular longitudinal array of microtubules, anchored to a basal body. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; photoreceptor inner segment : The inner segment of a vertebrate photoreceptor containing mitochondria, ribosomes and membranes where opsin molecules are assembled and passed to be part of the outer segment discs. ; photoreceptor outer segment : The outer segment of a vertebrate photoreceptor that contains a stack of membrane discs embedded with photoreceptor proteins. ; photoreceptor cell outer segment organization : A process that is carried out at the cellular level and results in the assembly, arrangement of constituent parts, or disassembly of the outer segment of a photoreceptor cell, a sensory cell that reacts to the presence of light. The outer segment of the photoreceptor cell contains the light-absorbing materials. ; protein localization to photoreceptor outer segment : A process in which a protein is transported to, or maintained in, a location within a photoreceptor outer segment. ;


Symbol
PCARE
Name
photoreceptor cilium actin regulator
Entrez ID
388939
Ensembl ID
ENSG00000179270    (more details)
KEGG ID
hsa:388939    (more details)
OMIM ID
613425
Uniprot ID
A6NGG8  
GO ID
hsa:388939    (more details)
Chromosome
21
Strand
-1
Start
43169008
End
43172805
miRNA Interactions
hsa-miR-338-3p (RPM: 158.4942) / hsa-miR-4657 (RPM: 0.0048) / hsa-miR-3065-3p (RPM: 17.8542) / hsa-miR-766-3p (RPM: 5.2956) / hsa-miR-4491 (RPM: 0.003) / hsa-miR-3670 (RPM: 0.0032) / hsa-miR-6871-3p (RPM: 0.027) / hsa-miR-6751-3p (RPM: 0.0166) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGGGGTGTACACCTTCACACAGTGACCTTGTAAACAGCGTTGCAAAGAGTGGCATTCAGTTCTTGAAAAAGCCCAAAGCAATTCGGCCAGGATGTCAGGGCGGAAGTGAAAGAGGTTCCATCCCTTTGCTGGTTAAAAACTCCACCTGCTATGACGCTGGGGAGGGCCTGGCAGAGGAGCAGCCAAGTCCCAGGAGGAACCAAACCACAGCTAAAGGTCTTTGTCAGCTCATGGGAGATCCTGCTTCAGGCAAAAGGAAAGATATGGAAGGACTGATCCCAGGAACCAAAACCTCTTCATCCCAGCTGAACAAATCACAAAGCCACATGGCTAAGGATATTCCGTTCAAGACACAGGGTTCCCATGGATCACAAGGGGCAGACTTTTCTGGAGATGAGAGTGAGGAAAGTAGTACCCAAGATACTTCCAAATGGAAAAGGACAGCAAAATGTCACACGTCAAGCACACAGAGCCACTGCTACCAAACCATCCACCCTGCTCATGAGCCTGAAGGCAAAGTGGACTTCCCGGAGCCTCTGGTAAAGGCCCACCAGCAGGCTTACACCTATCTACACTCCAGCCTCTCCAAATATGAAGCAATTCTGTGCATCATCCATCAGGCCACCCAGACCCGGGAGCTGCTGCAGCCCATGGTCAGCTTCTTGCTGCTGTGCTTTGAGGAGATCAGCCAGCTGTTGGGGGAGATCTCCAAGGATGGAGAAGTGCTCCTGCAGGAAGTCAGGGAGGATCTGGCTTGGCCTTTGAAGAAAAGAGAGCCCCAGGAGCAGCCAAATCTCCTGCAACAGCTGCTACAGTACACAGTCAGCAAGCTGCAGGTGCTCAATGGCACAGTGGCCTCGCTCACCGGCAGCTTCCTGGAGGGCTCCAGCAGCTACCTCCACTCCACTGCAACCCACTTGGAAAATAAGCTGAGCACAAAAAGGAATGTGGATGAACGCCTCCTGAGGGCTCTGAGGCAGCTAGAGAGCCTGGCGAGTGGCTGTGGCGACCCTGGGGTGCAGGGTCTCCCCTTATGCTCTGAGGACAGTGGCATTGGTGCTGACAATGAGTCCGTGCAGTCGGTGGACAAGCTGGGCAAGCAAACCAGCTGGGACCTTGCACCAGAGCCCGAAGAATGGAAGTCGGTGACTTCACCCCACACAGAGGCCAGGCAGTCAGGACACACCTGGCAGCAAAGTCCATTCTGTTTGGGCTCAGGCAGACCCCAGGACTGCCTGCTCTCAGGGGCTCCTATGGCAAAGGTTCAGCCACGAGCACAGGACGAAGCAAGGAGCCCATGCCTCTCCAGTACAAGCCCAGAAAATATCACCTCCCCACCTTTGAAGCTGGGGACAAGCACCCCATGTGATTCCTTTGGGATTGGGGTCTCTGTGGAACCACACCTTTCCAAAACCTCCAGGCCGATGGACGCTTCATCTCTTAGTGACAGCGAGGACAGCAGCCCAGAGGAGGAGGAGGAAGACAAAATGAGCAGCATGAGTCTGTGTGCCTGGCAGGAAAAAACTCCACATTCAAGGCCACAATCTTCACCTGCTGACCGGGAAAGCCCATTTCAGGCCCGCACCAGGAGGCTTAGGAGCCTCCAGGCCCAGGAAATGATTCTGAAGATGAAGGAGTCAATCAGCGAAAGGATCAAGTTTGTCCCTGTGCCCTGTGGGCACCAGGACTGGTCTGAGGAGGAGGAGGGGAGGACAGTGGTCCCCCCAAGACCTAGCACGGTAAGTGGCAGCAGGAGGGCCCCTGAGAGGCAGACGAGGTCCCAGTCAGAGTCGTGTCTCCAGAGTCACGTGGAGGACCCCACCTTTCAGGAGCTGCGAAGGGTCCAGAGGGACCTCAGTCAGAAGCTGGAGGCATTTTATGCCCTGGGTGCCAAAGGGCAGGGGCAGAGCCAGGAGCAAATTCTGCAGCCCAGAGCAGCCGCCGTGTGGCCCAATGGCACCTGCAGGGTCAGTCCAAGCAACACCACCAGCAGGCTCAAGGCATCCCTCACCAAGAACTTCAGTATTTTGCCTAGTCAGGACAAGAGCATCTTGCAGAAATGCAATCCCCATCCTGAGGACGAACAAGGCAAAGCTGGGAAGCTTCCAAATGCCATCCCATCAGGAGAGGTCAGTGAGGCTGCCAAGGCCACAGACTGGAATGTCAGAGGCTGTCCCACCAGAACATCCGTCAAGAAGCTTATTGAAACTTTCAGTCCCACGGAGAGTCTGAGGATGCTGGGGGACTCTAAGGACGCTGGGGCAAGTCCCTGCCTCAGGAATTGCATCATGCCCCCCAGATTTCCCAAGTACACAGGGCTTGCCCCTTTGTATCCGAAGCCCCAAATTTCTCCAGCATCAGGCAGAGAATCTCTCAAAATGGGCATAGGCTGGAAGCCCTTAGCACCTATCTTTCCCCCTCTGCCTAAAGCAGAAGCAGCCAAGAGTGAGGAGCTCAGCTGTGAAATGGAGGGGAACCTCGAGCACCTCCCTCCACCGCCTATGGAAGTTCTGATGGACAAATCATTCGCTTCTCTGGAGTCCCCAGAAAGCAGCAAGTCCACAGAGAACTCCCCCAAGGAAACCCAGGAGCCAGGGCCGGGAGAGGCTGGCCCCACCAGGAGAACATGGGCTTCCCCAAAGCTGAGGGCCTCTGTGAGCCCCCTGGACTTGCTGCCCAGCAAGAGCACCGCCAGCCTGACCAAGCCTCACAGCACAGGGCCAGGGAGTGGCAGGAGCAGCTGCCAGCCCAGGAAGCCAGCCCTGGACCTGAGCAGCCCACCAGCCACCAGCCAAAGCCCCGAGGTGAAGGGTGGGACTTGGAGTCAGGCAGAGAAGGCCACCAGCCTCTACAGGCAGCCCCGGAAGGCCATCGCCTGGCACCACTCCGGCCCTCCATCTGGACAAAACAGGACCTCAGAGTCCAGCCTGGCCAGACCAAGGCAGAGCCGAGAGAGAAGCCCCCCTGTGGGCAGAAAGGCCTCTCCCACGAGGACACACTGGGTGCCTCAAGCAGACAAGAGGCGCCGGAGCCTTCCCTCCTCTTACAGACCTGCCCAGCCAAGCCCCTCTGCTGTGCAGACGCCCCCCAGCCCACCTGTGAGCCCCAGGGTGCTAAGCCCACCCACCACAAAGCGGCGAACTTCCCCACCGCACCAGCCCAAGTTGCCCAACCCTCCCCCCGAGAGTGCACCTGCTCAGTGCAAGGTCCCCAGCCCCCCAACCCAGCACCCAGAAGCAAGCCCCCCTTTCTCGATTCCCTCCCCATCACCCCCAATGTCCCCTTCTCAGGAGCACAAGGAAACAAGAGACTCTGAAGACAGCCAAGCAGTCATAGCCAAAGTGTCTGGGAACACACATTCCATATTCTGCCCAGCTACCTCCTCTCTGTTTGAAGCTAAACCGCCACTCTCAACAGCCCACCCACTGACCCCACCATCGCTGCCGCCAGAGGCTGGGGGCCCTCTCGGGAACCCAGCAGAATGCTGGAAGAACAGCTCAGGGCCTTGGCTGAGAGCAGACTCGCAGCGGAGAGCAGCTCTGTGTGCCCTCAACCCTCTGCCTTTCCTCAGGAGGACAGCTTCTGACCGCCAGCCAGGTGGCCGACCGCAGCCTCCCACCTTGGACCCCACCAGCACCTCTTATGAATCCCAGCTCGGCCAGAACAGCAGCAGCGAGGAGAGCCCTAAGAAGGACACAGAGCCGGGGAGCAGCCCCTGTTCCCCTGAACTGCAGGGCGGCACCAGGCGTGCATCTCCCCCAGAGTTCTGTGTGCTGGGCCACGGGCTGCAACCGGAGCCTCGGACCGGCCACATCCAGGACAAATCCCAGCCAGAGGCGCAGCCCCAGCAAGAGGAGGTGTCCTGA

Back to List