Details for gene: UBAP1L


ubiquitin binding : Interacting selectively and non-covalently with ubiquitin, a protein that when covalently bound to other cellular proteins marks them for proteolytic degradation. ; ESCRT I complex : An endosomal sorting complex required for transport. It consists of the class E vacuolar protein sorting (Vps) proteins and interacts with ubiquitinated cargoes. ; ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway : The chemical reactions and pathways resulting in the breakdown of a protein or peptide covalently tagged with ubiquitin, via the multivesicular body (MVB) sorting pathway; ubiquitin-tagged proteins are sorted into MVBs, and delivered to a lysosome/vacuole for degradation. ;


Symbol
UBAP1L
Name
ubiquitin associated protein 1 like
Entrez ID
390595
Ensembl ID
ENSG00000246922    (more details)
KEGG ID
hsa:390595    (more details)
OMIM ID
FALSE
Uniprot ID
F5GYI3  
GO ID
hsa:390595    (more details)
Chromosome
4
Strand
-1
Start
186191567
End
186213463
miRNA Interactions
hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-218-5p (RPM: 36.775) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGAATGCCCTCGATGGTGTTCCTTTCAAGTTGCCCAAGGGCTTTGTGATAGGCACAGAGCCTCTCCCTGGGCCAGAACTCAGCGTCCCGGCCTGCGGGGAAGTTCTGCTGGGTTCTATGCACGACTTCAGCCTGGAGAGGACGGCACTCTTCTGGGTGGAGGCCGCCGGCCAGGGACCCAGCCCGTACCAGTGCGGTGACCCGGGGACAGCGTCAGCCCCTCCAGCCTGGCTCTTGCTAGTCAGCCCCGAACATGGGCTGGCGCCTGCGCCCACCACAATCAGAGACCCGGAGGCCGGACACCAGGAGAGGCCGGAGGAGGAGGGTGAGGACGAGGCAGAAGCCTCCTCTGGCAGCGAGGAAGAGCCGGCCCCCAGCAGCCTCCAACCGGGCTCCCCGGCGAGCCCCGGCCCCGGCCGTCGCCTGTGCTCGCTGGACGTGCTACGCGGCGTGCGGTTGGAGCTGGCAGGGGCGCGGCGGCGGCTCTCCGAGGGGAAGCTGGTCTCCCGGCCCCGCGCCCTCCTGCATGGCCTCCGCGGCCACCGCGCGCTGAGCCTGTGCCCGAGCCCTGCGCAGTCCCCCAGGTCTGCATCACCCCCGGGGCCCGCGCCCCAGCACCCCGCCGCCCCCGCGTCGCCCCCGCGGCCCTCCACGGCAGGCGCCATCCCCCCGCTGCGGAGCCACAAGCCTACGGTCGCGTCCCTCAGCCCGTACACCTGTCTGCCACCTCTTGGGGGGGCACCCCAACCTCTCAACCCCCACAAGTCACACCCTGATACTGCGGCTGACCTGCTGTCCGCCCTGAGCCAGGAGGAGCAAGACCTCATTGGGCCAGTGGTCGCCCTGGGATATCCCCTGCGAAGGGCCATCATAGCTCTGCAGAAGACAGGGAGGCAGAGCCTGAGCCAGTTTCTCAGCTACCTCAGTGCCTGTGACCGCCTGTTACGTCAGGGATATGAGGAAGGCCTGGTGGATGAGGCCATGGAGATGTTCCAGTTCTCCGAGAGCCAGGCAGGGGAGTTCCTGCGCCTCTGGGAGCAGTTCAGTGACATGGGCTTCCAGCAGGACCGGATCAAGGAGGTGCTGCTGGTCCATGGCAACCGCCGAGAGCAAGCCCTGGAGGAGCTGGTGGCCTGTGCCCAGTGA

Back to List