Details for gene: PRCD


photoreceptor outer segment membrane : The membrane surrounding the outer segment of a vertebrate photoreceptor. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; endoplasmic reticulum : The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached). ; Golgi apparatus : A membrane-bound cytoplasmic organelle of the endomembrane system that further processes the core oligosaccharides (e.g. N-glycans) added to proteins in the endoplasmic reticulum and packages them into membrane-bound vesicles. The Golgi apparatus operates at the intersection of the secretory, lysosomal, and endocytic pathways. ; extracellular region : The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; photoreceptor outer segment : The outer segment of a vertebrate photoreceptor that contains a stack of membrane discs embedded with photoreceptor proteins. ;


Symbol
PRCD
Name
photoreceptor disc component
Entrez ID
768206
Ensembl ID
ENSG00000214140    (more details)
KEGG ID
hsa:768206    (more details)
OMIM ID
610598
Uniprot ID
Q00LT1  
GO ID
hsa:768206    (more details)
Chromosome
10
Strand
1
Start
127737185
End
127741183
miRNA Interactions
hsa-miR-27a-3p (RPM: 980.3062) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGTGCACCACCCTTTTCCTGCTCAGCACCCTGGCCATGCTCTGGCGCCGCCGATTTGCCAACCGAGTCCAACCAGAGCCCAGCGACGTGGATGGGGCAGCTAGGGGCAGCAGCTTGGATGCGGACCCTCAGTCCTCAGGCAGGGAGAAAGAACCTCTGAAGTAA

Back to List