Details for gene: COL4A1


extracellular matrix structural constituent : The action of a molecule that contributes to the structural integrity of the extracellular matrix. ; collagen trimer : A protein complex consisting of three collagen chains assembled into a left-handed triple helix. These trimers typically assemble into higher order structures. ; extracellular region : The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; basement membrane : A collagen-containing extracellular matrix consisting of a thin layer of dense material found in various animal tissues interposed between the cells and the adjacent connective tissue. It consists of the basal lamina plus an associated layer of reticulin fibers. ; angiogenesis : Blood vessel formation when new vessels emerge from the proliferation of pre-existing blood vessels. ; extracellular space : That part of a multicellular organism outside the cells proper, usually taken to be outside the plasma membranes, and occupied by fluid. ; extracellular matrix organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of an extracellular matrix. ; extracellular matrix : A structure lying external to one or more cells, which provides structural support, biochemical or biomechanical cues for cells or tissues. ; collagen-containing extracellular matrix : An extracellular matrix consisting mainly of proteins (especially collagen) and glycosaminoglycans (mostly as proteoglycans) that provides not only essential physical scaffolding for the cellular constituents but can also initiate crucial biochemical and biomechanical cues required for tissue morphogenesis, differentiation and homeostasis. The components are secreted by cells in the vicinity and form a sheet underlying or overlying cells such as endothelial and epithelial cells. ; extracellular matrix structural constituent conferring tensile strength : A constituent of the extracellular matrix that enables the matrix to resist longitudinal stress. ; endoplasmic reticulum lumen : The volume enclosed by the membranes of the endoplasmic reticulum. ; branching involved in blood vessel morphogenesis : The process of coordinated growth and sprouting of blood vessels giving rise to the organized vascular system. ; retinal blood vessel morphogenesis : The process whose specific outcome is the progression of a blood vessel of the retina over time, from its formation to the mature structure. ; platelet-derived growth factor binding : Interacting selectively and non-covalently with platelet-derived growth factor. ; brain development : The process whose specific outcome is the progression of the brain over time, from its formation to the mature structure. Brain development begins with patterning events in the neural tube and ends with the mature structure that is the center of thought and emotion. The brain is responsible for the coordination and control of bodily activities and the interpretation of information from the senses (sight, hearing, smell, etc.). ; neuromuscular junction development : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of a neuromuscular junction. ; epithelial cell differentiation : The process in which a relatively unspecialized cell acquires specialized features of an epithelial cell, any of the cells making up an epithelium. ; collagen-activated tyrosine kinase receptor signaling pathway : A series of molecular signals initiated by the binding of collagen to a receptor on the surface of the target cell where the receptor possesses tyrosine kinase activity. The pathway ends with regulation of a downstream cellular process, e.g. transcription. ; blood vessel morphogenesis : The process in which the anatomical structures of blood vessels are generated and organized. The blood vessel is the vasculature carrying blood. ; renal tubule morphogenesis : The process in which the renal tubule is generated by specification of cell fate, through the maintenance of cell polarity, regulated cell proliferation and morphogenetic cell rearrangements, shape changes and growth. A renal tubule is a tube that filters, re-absorbs and secretes substances to rid an organism of waste and to play a role in fluid homeostasis. ; cellular response to amino acid stimulus : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an amino acid stimulus. An amino acid is a carboxylic acids containing one or more amino groups. ; basement membrane organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of the basement membrane. ; collagen type IV trimer : A collagen heterotrimer containing type IV alpha chains; [alpha1(IV)]2alpha2(IV) trimers are commonly observed, although more type IV alpha chains exist and may be present in type IV trimers; type IV collagen triple helices associate to form 3 dimensional nets within basement membranes. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; cellular anatomical entity : A part of a cellular organism that is either an immaterial entity or a material entity with granularity above the level of a protein complex but below that of an anatomical system. Or, a substance produced by a cellular organism with granularity above the level of a protein complex. ; collagen fibril organization : Any process that determines the size and arrangement of collagen fibrils within an extracellular matrix. ;


Symbol
COL4A1
Name
collagen type IV alpha 1 chain
Entrez ID
1282
Ensembl ID
ENSG00000187498    (more details)
KEGG ID
hsa:1282    (more details)
OMIM ID
120130
Uniprot ID
A5PKV2  
GO ID
hsa:1282    (more details)
Chromosome
3
Strand
-1
Start
45917903
End
45995824
miRNA Interactions
hsa-miR-29b-3p (RPM: 118.8178) / hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-29c-3p (RPM: 661.3514) / hsa-miR-30d-5p (RPM: 9562.1366) / hsa-miR-29a-3p (RPM: 1246.9046) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-506-3p (RPM: 0.6452) / hsa-miR-101-3p (RPM: 3335.0564) / hsa-miR-106a-5p (RPM: 7.9736) / hsa-miR-3065-5p (RPM: 5.6206) / hsa-miR-335-3p (RPM: 837.9252) / hsa-miR-758-3p (RPM: 5.044) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-92a-3p (RPM: 16961.15) / hsa-miR-138-5p (RPM: 67.2828) / hsa-miR-590-3p (RPM: 4.5954) / hsa-miR-495-3p (RPM: 8.062) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-5688 (RPM: 0.6258) / hsa-miR-148a-3p (RPM: 10339.6222) / hsa-miR-330-5p (RPM: 48.9814) / hsa-miR-767-5p (RPM: 20.579) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-let-7f-5p (RPM: 17066.6836) / hsa-miR-4504 (RPM: 0.0652) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-624-5p (RPM: 0.5246) / hsa-let-7c-5p (RPM: 4028.6728) / hsa-miR-125a-5p (RPM: 11539.4616) / hsa-miR-148b-3p (RPM: 970.7614) / hsa-miR-152-3p (RPM: 242.0024) / hsa-miR-548d-3p (RPM: 0.0012) / hsa-miR-23b-5p (RPM: 1.333) / hsa-let-7i-5p (RPM: 2025.2084) / hsa-miR-584-5p (RPM: 65.7532) / hsa-miR-186-5p (RPM: 1645.2832) / hsa-miR-98-5p (RPM: 1660.0964) / hsa-let-7e-5p (RPM: 3790.2074) / hsa-miR-429 (RPM: 100.5032) / hsa-let-7g-5p (RPM: 3559.4376) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-miR-7-1-3p (RPM: 13.9534) / hsa-miR-542-3p (RPM: 2.7294) / hsa-let-7f-1-3p (RPM: 9.5776) / hsa-miR-7-2-3p (RPM: 0.451) / hsa-let-7b-3p (RPM: 92.0818) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-1305 (RPM: 0.128) / hsa-let-7a-3p (RPM: 33.7298) / hsa-miR-494-3p (RPM: 1.1806) / hsa-miR-21-5p (RPM: 5494.851) / hsa-miR-766-3p (RPM: 5.2956) / hsa-miR-22-3p (RPM: 26348.475) / hsa-miR-4511 (RPM: 0.216) / hsa-miR-331-3p (RPM: 130.5788) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-193b-3p (RPM: 184.968) / hsa-miR-197-3p (RPM: 347.3274) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-378b (RPM: 0.313) / hsa-miR-378c (RPM: 29.1044) / hsa-miR-378a-3p (RPM: 1540.7796) / hsa-let-7g-3p (RPM: 7.0448) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-23a-3p (RPM: 613.2568) / hsa-miR-18a-3p (RPM: 5.394) / hsa-miR-22-5p (RPM: 21.6092) / hsa-miR-25-3p (RPM: 1063.0626) / hsa-miR-221-5p (RPM: 32.1456) / hsa-miR-299-5p (RPM: 2.2688) / hsa-miR-5682 (RPM: 0.013) / hsa-miR-421 (RPM: 76.7678) / hsa-miR-1915-5p (RPM: 0.0172) / hsa-miR-769-3p (RPM: 3.6276) / hsa-miR-224-5p (RPM: 33.3102) / hsa-miR-140-3p (RPM: 779.3088) / hsa-miR-505-3p (RPM: 14.5424) / hsa-miR-146b-5p (RPM: 934.8654) / hsa-miR-874-3p (RPM: 170.3494) / hsa-miR-892a (RPM: 0.8232) / hsa-miR-17-5p (RPM: 83.6404) / hsa-miR-562 (RPM: 0.002) / hsa-miR-877-5p (RPM: 44.6348) / hsa-miR-4709-5p (RPM: 1.1454) / hsa-miR-4716-5p (RPM: 0.001) / hsa-miR-100-5p (RPM: 3365.0918) / hsa-miR-218-5p (RPM: 36.775) / hsa-miR-99a-5p (RPM: 1181.6944) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-6871-3p (RPM: 0.027) / hsa-miR-6808-3p (RPM: 0.0008) /
Involved Diseases
Volkmann cataract /
Involved Pathways
Sequence
ATGGGGCCCCGGCTCAGCGTCTGGCTGCTGCTGCTGCCCGCCGCCCTTCTGCTCCACGAGGAGCACAGCCGGGCCGCTGCGAAGGGTGGCTGTGCTGGCTCTGGCTGTGGCAAATGTGACTGCCATGGAGTGAAGGGACAAAAGGGTGAAAGAGGCCTCCCGGGGTTACAAGGTGTCATTGGGTTTCCTGGAATGCAAGGACCTGAGGGGCCACAGGGACCACCAGGACAAAAGGGTGATACTGGAGAACCAGGACTACCTGGAACAAAAGGGACAAGAGGACCTCCGGGAGCATCTGGCTACCCTGGAAACCCAGGACTTCCCGGAATTCCTGGCCAAGACGGCCCGCCAGGCCCCCCAGGTATTCCAGGATGCAATGGCACAAAGGGGGAGAGAGGGCCGCTCGGGCCTCCTGGCTTGCCTGGTTTCGCTGGAAATCCCGGACCACCAGGCTTACCAGGGATGAAGGGTGATCCAGGTGAGATACTTGGCCATGTGCCCGGGATGCTGTTGAAAGGTGAAAGAGGATTTCCCGGAATCCCAGGGACTCCAGGCCCACCAGGACTGCCAGGGCTTCAAGGTCCTGTTGGGCCTCCAGGATTTACCGGACCACCAGGTCCCCCAGGCCCTCCCGGCCCTCCAGGTGAAAAGGGACAAATGGGCTTAAGTTTTCAAGGACCAAAAGGTGACAAGGGTGACCAAGGGGTCAGTGGGCCTCCAGGAGTACCAGGACAAGCTCAAGTTCAAGAAAAAGGAGACTTCGCCACCAAGGGAGAAAAGGGCCAAAAAGGTGAACCTGGATTTCAGGGGATGCCAGGGGTCGGAGAGAAAGGTGAACCCGGAAAACCAGGACCCAGAGGCAAACCCGGAAAAGATGGTGACAAAGGGGAAAAAGGGAGTCCCGGTTTTCCTGGTGAACCCGGGTACCCAGGACTCATAGGCCGCCAGGGCCCGCAGGGAGAAAAGGGTGAAGCAGGTCCTCCTGGCCCACCTGGAATTGTTATAGGCACAGGACCTTTGGGAGAAAAAGGAGAGAGGGGCTACCCTGGAACTCCGGGGCCAAGAGGAGAGCCAGGCCCAAAAGGTTTCCCAGGACTACCAGGCCAACCCGGACCTCCAGGCCTCCCTGTACCTGGGCAGGCTGGTGCCCCTGGCTTCCCTGGTGAAAGAGGAGAAAAAGGTGACCGAGGATTTCCTGGTACATCTCTGCCAGGACCAAGTGGAAGAGATGGGCTCCCGGGTCCTCCTGGTTCCCCTGGGCCCCCTGGGCAGCCTGGCTACACAAATGGAATTGTGGAATGTCAGCCCGGACCTCCAGGTGACCAGGGTCCTCCTGGAATTCCAGGGCAGCCAGGATTTATAGGCGAAATTGGAGAGAAAGGTCAAAAAGGAGAGAGTTGCCTCATCTGTGATATAGACGGATATCGGGGGCCTCCCGGGCCACAGGGACCCCCGGGAGAAATAGGTTTCCCAGGGCAGCCAGGGGCCAAGGGCGACAGAGGTTTGCCTGGCAGAGATGGTGTTGCAGGAGTGCCAGGCCCTCAAGGTACACCAGGGCTGATAGGCCAGCCAGGAGCCAAGGGGGAGCCTGGTGAGTTTTATTTCGACTTGCGGCTCAAAGGTGACAAAGGAGACCCAGGCTTTCCAGGACAGCCCGGCATGCCAGGGAGAGCGGGTTCTCCTGGAAGAGATGGCCATCCGGGTCTTCCTGGCCCCAAGGGCTCGCCGGGTTCTGTAGGATTGAAAGGAGAGCGTGGCCCCCCTGGAGGAGTTGGATTCCCAGGCAGTCGTGGTGACACCGGCCCCCCTGGGCCTCCAGGATATGGTCCTGCTGGTCCCATTGGTGACAAAGGACAAGCAGGCTTTCCTGGAGGCCCTGGATCCCCAGGCCTGCCAGGTCCAAAGGGTGAACCAGGAAAAATTGTTCCTTTACCAGGCCCCCCTGGAGCAGAAGGACTGCCGGGGTCCCCAGGCTTCCCAGGTCCCCAAGGAGACCGAGGCTTTCCCGGAACCCCAGGAAGGCCAGGCCTGCCAGGAGAGAAGGGCGCTGTGGGCCAGCCAGGCATTGGATTTCCAGGGCCCCCCGGCCCCAAAGGTGTTGACGGCTTACCTGGAGACATGGGGCCACCGGGGACTCCAGGTCGCCCGGGATTTAATGGCTTACCTGGGAACCCAGGTGTGCAGGGCCAGAAGGGAGAGCCTGGAGTTGGTCTACCGGGACTCAAAGGTTTGCCAGGTCTTCCCGGCATTCCTGGCACACCCGGGGAGAAGGGGAGCATTGGGGTACCAGGCGTTCCTGGAGAACATGGAGCGATCGGACCCCCTGGGCTTCAGGGGATCAGAGGTGAACCGGGACCTCCTGGATTGCCAGGCTCCGTGGGGTCTCCAGGAGTTCCAGGAATAGGCCCCCCTGGAGCTAGGGGTCCCCCTGGAGGACAGGGACCACCGGGGTTGTCAGGCCCTCCTGGAATAAAAGGAGAGAAGGGTTTCCCCGGATTCCCTGGACTGGACATGCCGGGCCCTAAAGGAGATAAAGGGGCTCAAGGACTCCCTGGCATAACGGGACAGTCGGGGCTCCCTGGCCTTCCTGGACAGCAGGGGGCTCCTGGGATTCCTGGGTTTCCAGGTTCCAAGGGAGAAATGGGCGTCATGGGGACCCCCGGGCAGCCGGGCTCACCAGGACCAGTGGGTGCTCCTGGATTACCGGGTGAAAAAGGGGACCATGGCTTTCCGGGCTCCTCAGGACCCAGGGGAGACCCTGGCTTGAAAGGTGATAAGGGGGATGTCGGTCTCCCTGGCAAGCCTGGCTCCATGGATAAGGTGGACATGGGCAGCATGAAGGGCCAGAAAGGAGACCAAGGAGAGAAAGGACAAATTGGACCAATTGGTGAGAAGGGATCCCGAGGAGACCCTGGGACCCCAGGAGTGCCTGGAAAGGACGGGCAGGCAGGACAGCCTGGGCAGCCAGGACCTAAAGGTGATCCAGGTATAAGTGGAACCCCAGGTGCTCCAGGACTTCCGGGACCAAAAGGATCTGTTGGTGGAATGGGCTTGCCAGGAACACCTGGAGAGAAAGGTGTGCCTGGCATCCCTGGCCCACAAGGTTCACCTGGCTTACCTGGAGACAAAGGTGCAAAAGGAGAGAAAGGGCAGGCAGGCCCACCTGGCATAGGCATCCCAGGGCTGCGAGGTGAAAAGGGAGATCAAGGGATAGCGGGTTTCCCAGGAAGCCCTGGAGAGAAGGGAGAAAAAGGAAGCATTGGGATCCCAGGAATGCCAGGGTCCCCAGGCCTTAAAGGGTCTCCCGGGAGTGTTGGCTATCCAGGAAGTCCTGGGCTACCTGGAGAAAAAGGTGACAAAGGCCTCCCAGGATTGGATGGCATCCCTGGTGTCAAAGGAGAAGCAGGTCTTCCTGGGACTCCTGGCCCCACAGGCCCAGCTGGCCAGAAAGGGGAGCCAGGCAGTGATGGAATCCCGGGGTCAGCAGGAGAGAAGGGTGAACCAGGTCTACCAGGAAGAGGATTCCCAGGGTTTCCAGGGGCCAAAGGAGACAAAGGTTCAAAGGGTGAGGTGGGTTTCCCAGGATTAGCCGGGAGCCCAGGAATTCCTGGATCCAAAGGAGAGCAAGGATTCATGGGTCCTCCGGGGCCCCAGGGACAGCCGGGGTTACCGGGATCCCCAGGCCATGCCACGGAGGGGCCCAAAGGAGACCGCGGACCTCAGGGCCAGCCTGGCCTGCCAGGACTTCCGGGACCCATGGGGCCTCCAGGGCTTCCTGGGATTGATGGAGTTAAAGGTGACAAAGGAAATCCAGGCTGGCCAGGAGCACCCGGTGTCCCAGGGCCCAAGGGAGACCCTGGATTCCAGGGCATGCCTGGTATTGGTGGCTCTCCAGGAATCACAGGCTCTAAGGGTGATATGGGGCCTCCAGGAGTTCCAGGATTTCAAGGTCCAAAAGGTCTTCCTGGCCTCCAGGGAATTAAAGGTGATCAAGGCGATCAAGGCGTCCCGGGAGCTAAAGGTCTCCCGGGTCCTCCTGGCCCCCCAGGTCCTTACGACATCATCAAAGGGGAGCCCGGGCTCCCTGGTCCTGAGGGCCCCCCAGGGCTGAAAGGGCTTCAGGGACTGCCAGGCCCGAAAGGCCAGCAAGGTGTTACAGGATTGGTGGGTATACCTGGACCTCCAGGTATTCCTGGGTTTGACGGTGCCCCTGGCCAGAAAGGAGAGATGGGACCTGCCGGGCCTACTGGTCCAAGAGGATTTCCAGGTCCACCAGGCCCCGATGGGTTGCCAGGATCCATGGGGCCCCCAGGCACCCCATCTGTTGATCACGGCTTCCTTGTGACCAGGCATAGTCAAACAATAGATGACCCACAGTGTCCTTCTGGGACCAAAATTCTTTACCACGGGTACTCTTTGCTCTACGTGCAAGGCAATGAACGGGCCCATGGCCAGGACTTGGGCACGGCCGGCAGCTGCCTGCGCAAGTTCAGCACAATGCCCTTCCTGTTCTGCAATATTAACAACGTGTGCAACTTTGCATCACGAAATGACTACTCGTACTGGCTGTCCACCCCTGAGCCCATGCCCATGTCAATGGCACCCATCACGGGGGAAAACATAAGACCATTTATTAGTAGGTGTGCTGTGTGTGAGGCGCCTGCCATGGTGATGGCCGTGCACAGCCAGACCATTCAGATCCCACCGTGCCCCAGCGGGTGGTCCTCGCTGTGGATCGGCTACTCTTTTGTGATGCACACCAGCGCTGGTGCAGAAGGCTCTGGCCAAGCCCTGGCGTCCCCCGGCTCCTGCCTGGAGGAGTTTAGAAGTGCGCCATTCATCGAGTGTCACGGCCGTGGGACCTGCAATTACTACGCAAACGCTTACAGCTTTTGGCTCGCCACCATAGAGAGGAGCGAGATGTTCAAGAAGCCTACGCCGTCCACCTTGAAGGCAGGGGAGCTGCGCACGCACGTCAGCCGCTGCCAAGTCTGTATGAGAAGAACATAA

Back to List