Details for gene: PRX


nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; cell junction : A cellular component that forms a specialized region of connection between two or more cells, or between a cell and the extracellular matrix, or between two membrane-bound components of a cell, such as flagella. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; molecular_function : A molecular process that can be carried out by the action of a single macromolecular machine, usually via direct physical interactions with other molecular entities. Function in this sense denotes an action, or activity, that a gene product (or a complex) performs. These actions are described from two distinct but related perspectives: (1) biochemical activity, and (2) role as a component in a larger system/process. ; regulation of RNA splicing : Any process that modulates the frequency, rate or extent of RNA splicing, the process of removing sections of the primary RNA transcript to remove sequences not present in the mature form of the RNA and joining the remaining sections to form the mature form of the RNA. ; axon ensheathment : Any process in which the axon of a neuron is insulated, and that insulation maintained, thereby preventing dispersion of the electrical signal. ; peripheral nervous system myelin maintenance : The process in which the structure and material content of mature peripheral nervous system myelin is kept in a functional state. ;


Symbol
PRX
Name
periaxin
Entrez ID
57716
Ensembl ID
ENSG00000105227    (more details)
KEGG ID
hsa:57716    (more details)
OMIM ID
145900
Uniprot ID
Q9BXM0  
GO ID
hsa:57716    (more details)
Chromosome
19
Strand
-1
Start
40393766
End
40414793
miRNA Interactions
hsa-miR-132-3p (RPM: 82.2598) / hsa-miR-765 (RPM: 0.4272) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-5193 (RPM: 0.0094) / hsa-miR-3127-5p (RPM: 1.7222) / hsa-miR-3074-5p (RPM: 1.5192) / hsa-miR-301a-5p (RPM: 0.6676) / hsa-miR-1236-3p (RPM: 0.007) / hsa-miR-5698 (RPM: 0.003) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-4723-5p (RPM: 0.114) / hsa-miR-18a-3p (RPM: 5.394) / hsa-miR-1306-5p (RPM: 5.6804) / hsa-miR-361-3p (RPM: 73.5598) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-483-3p (RPM: 2.3898) / hsa-miR-3918 (RPM: 0.7636) / hsa-miR-744-5p (RPM: 290.9362) / hsa-miR-3194-5p (RPM: 0.013) / hsa-miR-1913 (RPM: 0.4166) / hsa-miR-3124-3p (RPM: 0.0136) / hsa-miR-5090 (RPM: 0.126) / hsa-miR-500a-3p (RPM: 426.0306) / hsa-miR-525-3p (RPM: 0.0038) / hsa-miR-524-3p (RPM: 0.0038) / hsa-miR-1908-5p (RPM: 10.1466) / hsa-miR-4467 (RPM: 0.046) / hsa-miR-663a (RPM: 0.1414) / hsa-miR-6825-5p (RPM: 0.261) / hsa-miR-6749-3p (RPM: 0.0746) / hsa-miR-7152-5p (RPM: 0.0734) / hsa-miR-7106-5p (RPM: 0.007) / hsa-miR-7109-5p (RPM: 0.0506) / hsa-miR-939-3p (RPM: 0.04) / hsa-miR-6783-3p (RPM: 0.0264) / hsa-miR-6890-3p (RPM: 0.0048) / hsa-miR-6885-5p (RPM: 0.0796) / hsa-miR-7111-5p (RPM: 0.0178) / hsa-miR-6870-5p (RPM: 0.0012) / hsa-miR-6742-3p (RPM: 0.0278) / hsa-miR-328-5p (RPM: 0.3124) / hsa-miR-6792-3p (RPM: 0.0262) / hsa-miR-6795-5p (RPM: 0.0092) / hsa-miR-6887-5p (RPM: 0.0144) / hsa-miR-6829-5p (RPM: 0.0126) / hsa-miR-3960 (RPM: 1.3044) / hsa-miR-6895-5p (RPM: 0.3264) / hsa-miR-6727-5p (RPM: 0.1378) / hsa-miR-4508 (RPM: 0.574) / hsa-miR-6775-5p (RPM: 0.0192) / hsa-miR-8072 (RPM: 0.1384) / hsa-miR-6894-3p (RPM: 0.1446) / hsa-miR-6787-5p (RPM: 0.1424) /
Involved Diseases
Volkmann cataract /
Involved Pathways
Metabolic pathways / Glycerolipid metabolism /
Sequence
ATGGAGGCCAGGAGCCGGAGTGCCGAGGAGCTGAGGCGGGCGGAGTTGGTGGAAATTATCGTGGAGACGGAGGCGCAGACCGGGGTCAGCGGCATCAACGTAGCGGGCGGCGGCAAAGAGGGAATCTTCGTTCGGGAGCTGCGCGAGGACTCACCCGCCGCCAGGAGCCTCAGCCTGCAGGAAGGGGACCAGCTGCTGAGTGCCCGAGTGTTCTTCGAGAACTTCAAGTACGAGGACGCACTACGCCTGCTGCAATGCGCCGAGCCTTACAAAGTCTCCTTCTGCCTGAAGCGCACTGTGCCCACCGGGGACCTGGCTCTGCGGCCCGGGACCGTGTCTGGCTACGAGATCAAGGGCCCGCGGGCCAAGGTGGCCAAGCTGAACATCCAGAGTCTGTCCCCTGTGAAGAAGAAGAAGATGGTGCCTGGGGCTCTGGGGGTCCCCGCTGACCTGGCCCCTGTTGACGTCGAGTTCTCCTTTCCCAAGTTCTCCCGCCTGCGTCGGGGCCTCAAAGCCGAGGCTGTCAAGGGTCCTGTCCCGGCTGCCCCTGCCCGCCGGCGCCTCCAGCTGCCTCGGCTGCGTGTACGAGAAGTGGCCGAAGAGGCTCAGGCAGCCCGGCTGGCCGCCGCCGCTCCTCCCCCCAGGAAAGCCAAGGTGGAGGCTGAGGTGGCTGCAGGAGCTCGTTTCACAGCCCCTCAGGTGGAGCTGGTTGGGCCGCGGCTGCCAGGGGCGGAGGTGGGTGTCCCCCAGGTCTCAGCCCCCAAGGCTGCCCCCTCAGCAGAGGCAGCTGGTGGCTTTGCCCTCCACCTGCCAACCCTTGGGCTCGGAGCCCCGGCTCCGCCTGCTGTGGAGGCCCCAGCCGTGGGAATCCAGGTCCCCCAGGTGGAGCTGCCTGCCTTGCCCTCACTGCCCACTCTGCCCACACTTCCCTGCCTAGAGACCCGGGAAGGGGCTGTGTCGGTAGTGGTGCCCACCCTGGATGTGGCAGCACCGACTGTGGGGGTGGACCTGGCCTTGCCGGGTGCAGAGGTGGAGGCCCGGGGAGAGGCACCTGAGGTGGCCCTGAAGATGCCCCGCCTTAGTTTTCCCCGATTTGGGGCTCGAGCAAAGGAAGTTGCTGAGGCCAAGGTAGCCAAGGTCAGCCCTGAGGCCAGGGTGAAAGGTCCCAGACTTCGAATGCCCACCTTTGGGCTTTCCCTCTTGGAGCCCCGGCCCGCTGCTCCTGAAGTTGTAGAGAGCAAGCTGAAGCTGCCCACCATCAAGATGCCCTCCCTTGGCATCGGAGTGTCAGGGCCCGAGGTCAAGGTGCCCAAGGGACCTGAAGTGAAGCTCCCCAAGGCTCCTGAGGTCAAGCTTCCAAAAGTGCCCGAGGCAGCCCTTCCAGAGGTTCGACTCCCAGAGGTGGAGCTCCCCAAGGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTAGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTACAGCTGCTGAAAGTGTCGGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTACAGCTGCCGAAAGTGTCAGAGATGAAACTCCCAGAGGTGTCAGAGGTGGCTGTGCCAGAGGTGCGGCTTCCAGAGGTGCAGCTGCCGAAAGTGCCAGAGATGAAAGTCCCTGAGATGAAGCTTCCAAAGGTGCCTGAGATGAAACTTCCTGAGATGAAACTCCCTGAAGTGCAACTCCCGAAGGTGCCCGAGATGGCCGTGCCCGATGTGCACCTCCCAGAAGTGCAGCTTCCAAAAGTCCCAGAGATGAAGCTCCCTGAGATGAAACTCCCTGAGGTGAAACTCCCGAAGGTGCCCGAGATGGCTGTGCCCGATGTGCACCTCCCGGAAGTGCAGCTCCCGAAAGTCCCAGAGATGAAACTCCCTAAAATGCCTGAGATGGCTGTGCCAGAGGTTCGACTCCCCGAGGTGCAGCTGCCAAAAGTCTCAGAGATGAAACTCCCCAAGGTGCCTGAAATGGCCGTGCCCGATGTGCACCTCCCAGAGGTGCAGCTGCCCAAAGTCTGTGAAATGAAAGTCCCTGACATGAAGCTCCCAGAGATAAAACTCCCCAAGGTGCCTGAGATGGCTGTGCCCGATGTGCACCTCCCCGAGGTGCAGCTGCCGAAAGTGTCAGAGATTCGGCTGCCGGAAATGCAAGTGCCGAAGGTTCCCGACGTGCATCTTCCGAAGGCACCAGAGGTGAAGCTGCCCAGGGCTCCGGAGGTGCAGCTAAAGGCCACCAAGGCAGAACAGGCAGAAGGGATGGAATTTGGCTTCAAGATGCCCAAGATGACCATGCCCAAGCTAGGGAGGGCAGAGTCCCCATCACGTGGCAAGCCAGGCGAGGCGGGTGCTGAGGTCTCAGGGAAGCTGGTAACACTTCCCTGTCTGCAGCCAGAGGTGGATGGTGAGGCTCATGTGGGTGTCCCCTCTCTCACTCTGCCTTCAGTGGAGCTAGACCTGCCAGGAGCACTTGGCCTGCAGGGGCAGGTCCCAGCCGCTAAAATGGGCAAGGGAGAGCGGGTGGAGGGCCCTGAGGTGGCAGCAGGGGTCAGGGAAGTGGGCTTCCGAGTGCCCTCTGTTGAAATTGTCACCCCACAGCTGCCCGCCGTGGAAATTGAGGAAGGGCGGCTGGAGATGATAGAGACAAAAGTCAAGCCCTCTTCCAAGTTCTCCTTACCTAAGTTTGGACTCTCGGGGCCAAAGGTGGCTAAGGCAGAGGCTGAGGGGGCTGGGCGAGCTACCAAGCTGAAGGTATCCAAATTTGCCATCTCACTCCCCAAGGCTCGGGTGGGGGCTGAGGCTGAGGCCAAAGGGGCTGGGGAGGCAGGCCTGCTGCCTGCCCTCGATCTGTCCATCCCACAGCTCAGCCTGGATGCCCACCTGCCCTCAGGCAAGGTAGAGGTGGCAGGGGCCGACCTCAAGTTCAAGGGGCCCAGGTTTGCTCTCCCCAAGTTTGGGGTCAGAGGCCGGGACACTGAGGCAGCAGAACTAGTGCCAGGGGTGGCTGAGTTGGAGGGCAAGGGCTGGGGCTGGGATGGGAGGGTGAAGATGCCCAAGCTGAAGATGCCTTCCTTTGGGCTGGCTCGAGGGAAGGAAGCAGAAGTTCAAGGTGATCGTGCCAGCCCGGGGGAAAAGGCTGAGTCCACCGCTGTGCAGCTTAAGATCCCCGAGGTGGAGCTGGTCACGCTGGGCGCCCAGGAGGAAGGGAGGGCAGAGGGGGCTGTGGCCGTCAGTGGAATGCAGCTGTCAGGCCTGAAGGTGTCCACAGCCGGGCAGGTGGTCACTGAGGGCCATGACGCGGGGCTGAGGATGCCTCCGCTGGGCATCTCCCTGCCACAGGTGGAGCTGACCGGCTTTGGGGAGGCAGGTACCCCAGGGCAGCAGGCTCAGAGTACAGTCCCTTCAGCAGAGGGCACAGCAGGCTACAGGGTTCAGGTGCCCCAGGTGACCCTGTCTCTGCCTGGAGCCCAGGTTGCAGGTGGTGAGCTGCTGGTGGGTGAGGGTGTCTTTAAGATGCCCACCGTGACAGTGCCCCAGCTTGAGCTGGACGTGGGGCTAAGCCGAGAGGCACAGGCGGGCGAGGCGGCCACAGGCGAGGGTGGGCTGAGGCTGAAGTTGCCCACACTGGGGGCCAGAGCTAGGGTGGGGGGCGAGGGTGCTGAGGAGCAGCCCCCAGGGGCCGAGCGTACCTTCTGCCTCTCACTGCCCGACGTGGAGCTCTCGCCATCCGGGGGCAACCATGCCGAGTACCAGGTGGCAGAGGGGGAGGGAGAGGCCGGACACAAGCTCAAGGTACGGCTGCCCCGGTTTGGCCTGGTGCGGGCCAAGGAGGGGGCCGAGGAGGGTGAGAAGGCCAAGAGCCCCAAACTCAGGCTGCCCCGAGTGGGCTTCAGCCAAAGTGAGATGGTCACTGGGGAAGGGTCCCCCAGCCCCGAGGAGGAGGAGGAGGAGGAGGAAGAGGGCAGTGGGGAAGGGGCCTCGGGTCGCCGGGGCCGGGTCCGGGTCCGCTTGCCACGTGTAGGCCTGGCGGCCCCTTCTAAAGCCTCTCGGGGGCAGGAGGGCGATGCAGCCCCCAAGTCCCCCGTCAGAGAGAAGTCACCCAAGTTCCGCTTCCCCAGGGTGTCCCTAAGCCCCAAGGCCCGGAGTGGGAGTGGGGACCAGGAAGAGGGTGGATTGCGGGTGCGGCTGCCCAGCGTGGGGTTTTCAGAGACAGGGGCTCCAGGCCCGGCCAGGATGGAGGGGGCTCAGGCTGCGGCTGTCTGA

Back to List