Details for gene: TGFBI


protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; cell adhesion : The attachment of a cell, either to another cell or to an underlying substrate such as the extracellular matrix, via cell adhesion molecules. ; cell population proliferation : The multiplication or reproduction of cells, resulting in the expansion of a cell population. ; integrin binding : Interacting selectively and non-covalently with an integrin. ; extracellular matrix binding : Interacting selectively and non-covalently with a component of the extracellular matrix. ; collagen binding : Interacting selectively and non-covalently with collagen, a group of fibrous proteins of very high tensile strength that form the main component of connective tissue in animals. Collagen is highly enriched in glycine (some regions are 33% glycine) and proline, occurring predominantly as 3-hydroxyproline (about 20%). ; extracellular space : That part of a multicellular organism outside the cells proper, usually taken to be outside the plasma membranes, and occupied by fluid. ; extracellular region : The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite. ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; angiogenesis : Blood vessel formation when new vessels emerge from the proliferation of pre-existing blood vessels. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; identical protein binding : Interacting selectively and non-covalently with an identical protein or proteins. ; chondrocyte differentiation : The process in which a chondroblast acquires specialized structural and/or functional features of a chondrocyte. A chondrocyte is a polymorphic cell that forms cartilage. ; extracellular matrix organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of an extracellular matrix. ; basement membrane : A collagen-containing extracellular matrix consisting of a thin layer of dense material found in various animal tissues interposed between the cells and the adjacent connective tissue. It consists of the basal lamina plus an associated layer of reticulin fibers. ; extracellular matrix : A structure lying external to one or more cells, which provides structural support, biochemical or biomechanical cues for cells or tissues. ; extracellular exosome : A vesicle that is released into the extracellular region by fusion of the limiting endosomal membrane of a multivesicular body with the plasma membrane. Extracellular exosomes, also simply called exosomes, have a diameter of about 40-100 nm. ; collagen-containing extracellular matrix : An extracellular matrix consisting mainly of proteins (especially collagen) and glycosaminoglycans (mostly as proteoglycans) that provides not only essential physical scaffolding for the cellular constituents but can also initiate crucial biochemical and biomechanical cues required for tissue morphogenesis, differentiation and homeostasis. The components are secreted by cells in the vicinity and form a sheet underlying or overlying cells such as endothelial and epithelial cells. ; extracellular matrix structural constituent : The action of a molecule that contributes to the structural integrity of the extracellular matrix. ; cell adhesion molecule binding : Interacting selectively and non-covalently with a cell adhesion molecule. ; trans-Golgi network : The network of interconnected tubular and cisternal structures located within the Golgi apparatus on the side distal to the endoplasmic reticulum, from which secretory vesicles emerge. The trans-Golgi network is important in the later stages of protein secretion where it is thought to play a key role in the sorting and targeting of secreted proteins to the correct destination. ; negative regulation of cell adhesion : Any process that stops, prevents, or reduces the frequency, rate or extent of cell adhesion. ;


Symbol
TGFBI
Name
transforming growth factor beta induced
Entrez ID
7045
Ensembl ID
ENSG00000120708    (more details)
KEGG ID
hsa:7045    (more details)
OMIM ID
121820
Uniprot ID
A0A0S2Z4Q2  
GO ID
hsa:7045    (more details)
Chromosome
9
Strand
1
Start
97412096
End
97496125
miRNA Interactions
hsa-miR-212-3p (RPM: 7.7608) / hsa-miR-132-3p (RPM: 82.2598) / hsa-miR-29c-3p (RPM: 661.3514) / hsa-miR-515-5p (RPM: 0.18) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-450b-5p (RPM: 4.6184) / hsa-miR-19b-3p (RPM: 197.0578) / hsa-miR-19a-3p (RPM: 25.4064) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-200b-3p (RPM: 566.8348) / hsa-miR-9-5p (RPM: 3525.806) / hsa-miR-429 (RPM: 100.5032) / hsa-miR-30e-3p (RPM: 538.304) / hsa-miR-30a-3p (RPM: 889.1386) / hsa-miR-449a (RPM: 1.3118) / hsa-miR-372-3p (RPM: 0.0034) / hsa-miR-520f-3p (RPM: 0.0042) / hsa-miR-373-3p (RPM: 0.0958) / hsa-miR-194-5p (RPM: 48.9448) / hsa-miR-21-5p (RPM: 5494.851) / hsa-miR-766-3p (RPM: 5.2956) / hsa-miR-145-5p (RPM: 548.8656) / hsa-miR-5690 (RPM: 1.0164) / hsa-miR-449b-5p (RPM: 1.2108) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-629-3p (RPM: 0.715) / hsa-miR-365b-5p (RPM: 1.3016) / hsa-miR-361-3p (RPM: 73.5598) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-675-5p (RPM: 0.6068) / hsa-miR-3925-3p (RPM: 0.0022) / hsa-miR-1322 (RPM: 0.1004) / hsa-miR-654-3p (RPM: 97.06) / hsa-miR-941 (RPM: 399.631) / hsa-miR-516a-5p (RPM: 0.1184) / hsa-miR-7977 (RPM: 18.3058) / hsa-miR-6787-3p (RPM: 0.1544) / hsa-miR-6854-5p (RPM: 0.1492) / hsa-miR-580-5p (RPM: 0.002) /
Involved Diseases
Posterior capsule opacification (PCO) /
Involved Pathways
Sequence
ATGGCGCTCTTCGTGCGGCTGCTGGCTCTCGCCCTGGCTCTGGCCCTGGGCCCCGCCGCGACCCTGGCGGGTCCCGCCAAGTCGCCCTACCAGCTGGTGCTGCAGCACAGCAGGCTCCGGGGCCGCCAGCACGGCCCCAACGTGTGTGCTGTGCAGAAGGTTATTGGCACTAATAGGAAGTACTTCACCAACTGCAAGCAGTGGTACCAAAGGAAAATCTGTGGCAAATCAACAGTCATCAGCTACGAGTGCTGTCCTGGATATGAAAAGGTCCCTGGGGAGAAGGGCTGTCCAGCAGCCCTACCACTCTCAAACCTTTACGAGACCCTGGGAGTCGTTGGATCCACCACCACTCAGCTGTACACGGACCGCACGGAGAAGCTGAGGCCTGAGATGGAGGGGCCCGGCAGCTTCACCATCTTCGCCCCTAGCAACGAGGCCTGGGCCTCCTTGCCAGCTGAAGTGCTGGACTCCCTGGTCAGCAATGTCAACATTGAGCTGCTCAATGCCCTCCGCTACCATATGGTGGGCAGGCGAGTCCTGACTGATGAGCTGAAACACGGCATGACCCTCACCTCTATGTACCAGAATTCCAACATCCAGATCCACCACTATCCTAATGGGATTGTAACTGTGAACTGTGCCCGGCTGCTGAAAGCCGACCACCATGCAACCAACGGGGTGGTGCACCTCATCGATAAGGTCATCTCCACCATCACCAACAACATCCAGCAGATCATTGAGATCGAGGACACCTTTGAGACCCTTCGGGCTGCTGTGGCTGCATCAGGGCTCAACACGATGCTTGAAGGTAACGGCCAGTACACGCTTTTGGCCCCGACCAATGAGGCCTTCGAGAAGATCCCTAGTGAGACTTTGAACCGTATCCTGGGCGACCCAGAAGCCCTGAGAGACCTGCTGAACAACCACATCTTGAAGTCAGCTATGTGTGCTGAAGCCATCGTTGCGGGGCTGTCTGTAGAGACCCTGGAGGGCACGACACTGGAGGTGGGCTGCAGCGGGGACATGCTCACTATCAACGGGAAGGCGATCATCTCCAATAAAGACATCCTAGCCACCAACGGGGTGATCCACTACATTGATGAGCTACTCATCCCAGACTCAGCCAAGACACTATTTGAATTGGCTGCAGAGTCTGATGTGTCCACAGCCATTGACCTTTTCAGACAAGCCGGCCTCGGCAATCATCTCTCTGGAAGTGAGCGGTTGACCCTCCTGGCTCCCCTGAATTCTGTATTCAAAGATGGAACCCCTCCAATTGATGCCCATACAAGGAATTTGCTTCGGAACCACATAATTAAAGACCAGCTGGCCTCTAAGTATCTGTACCATGGACAGACCCTGGAAACTCTGGGCGGCAAAAAACTGAGAGTTTTTGTTTATCGTAATAGCCTCTGCATTGAGAACAGCTGCATCGCGGCCCACGACAAGAGGGGGAGGTACGGGACCCTGTTCACGATGGACCGGGTGCTGACCCCCCCAATGGGGACTGTCATGGATGTCCTGAAGGGAGACAATCGCTTTAGCATGCTGGTAGCTGCCATCCAGTCTGCAGGACTGACGGAGACCCTCAACCGGGAAGGAGTCTACACAGTCTTTGCTCCCACAAATGAAGCCTTCCGAGCCCTGCCACCAAGAGAACGGAGCAGACTCTTGGGAGATGCCAAGGAACTTGCCAACATCCTGAAATACCACATTGGTGATGAAATCCTGGTTAGCGGAGGCATCGGGGCCCTGGTGCGGCTAAAGTCTCTCCAAGGTGACAAGCTGGAAGTCAGCTTGAAAAACAATGTGGTGAGTGTCAACAAGGAGCCTGTTGCCGAGCCTGACATCATGGCCACAAATGGCGTGGTCCATGTCATCACCAATGTTCTGCAGCCTCCAGCCAACAGACCTCAGGAAAGAGGGGATGAACTTGCAGACTCTGCGCTTGAGATCTTCAAACAAGCATCAGCGTTTTCCAGGGCTTCCCAGAGGTCTGTGCGACTAGCCCCTGTCTATCAAAAGTTATTAGAGAGGATGAAGCATTAG

Back to List