Details for gene: SLC4A11


integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; inorganic anion exchanger activity : Enables the transfer of a solute or solutes from one side of a membrane to the other according to the reaction: inorganic anion A(out) + inorganic anion B(in) = inorganic anion A(in) + inorganic anion B(out). ; anion transport : The directed movement of anions, atoms or small molecules with a net negative charge, into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; ion transport : The directed movement of charged atoms or small charged molecules into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; symporter activity : Enables the active transport of a solute across a membrane by a mechanism whereby two or more species are transported together in the same direction in a tightly coupled process not directly linked to a form of energy other than chemiosmotic energy. ; sodium ion transmembrane transport : A process in which a sodium ion is transported from one side of a membrane to the other by means of some agent such as a transporter or pore. ; basolateral plasma membrane : The region of the plasma membrane that includes the basal end and sides of the cell. Often used in reference to animal polarized epithelial membranes, where the basal membrane is the part attached to the extracellular matrix, or in plant cells, where the basal membrane is defined with respect to the zygotic axis. ; protein dimerization activity : The formation of a protein dimer, a macromolecular structure consists of two noncovalently associated identical or nonidentical subunits. ; anion transmembrane transport : The process in which an anion is transported across a membrane. ; anion:anion antiporter activity : Enables the transfer of a solute or solutes from one side of a membrane to the other according to the reaction: anion A(out) + anion B(in) = anion A(in) + anion B(out). ; transmembrane transport : The process in which a solute is transported across a lipid bilayer, from one side of a membrane to the other. ; cellular response to oxidative stress : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of oxidative stress, a state often resulting from exposure to high levels of reactive oxygen species, e.g. superoxide anions, hydrogen peroxide (H2O2), and hydroxyl radicals. ; transmembrane transporter activity : Enables the transfer of a substance, usually a specific substance or a group of related substances, from one side of a membrane to the other. ; apical plasma membrane : The region of the plasma membrane located at the apical end of the cell. ; water transmembrane transporter activity : Enables the transfer of water (H2O) from one side of a membrane to the other. ; vesicle membrane : The lipid bilayer surrounding any membrane-bounded vesicle in the cell. ; regulation of mitochondrial membrane potential : Any process that modulates the establishment or extent of the mitochondrial membrane potential, the electric potential existing across the mitochondrial membrane arising from charges in the membrane itself and from the charges present in the media on either side of the membrane. ; ion homeostasis : Any process involved in the maintenance of an internal steady state of ions within an organism or cell. ; proton transmembrane transporter activity : Enables the transfer of a proton from one side of a membrane to the other. ; proton transmembrane transport : The directed movement of a proton across a membrane. ; regulation of mesenchymal stem cell differentiation : Any process that modulates the frequency, rate or extent of mesenchymal stem cell differentiation. ; cellular hypotonic response : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of detection of, or exposure to, a hypotonic environment, i.e. an environment with a lower concentration of solutes than the organism or cell. ; sodium channel activity : Enables the facilitated diffusion of a sodium ion (by an energy-independent process) involving passage through a transmembrane aqueous pore or channel without evidence for a carrier-mediated mechanism. ; bicarbonate transmembrane transporter activity : Enables the transfer of bicarbonate from one side of a membrane to the other. Bicarbonate is the hydrogencarbonate ion, HCO3-. ; proton channel activity : Enables the facilitated diffusion of a hydrogen ion (by an energy-independent process) involving passage through a transmembrane aqueous pore or channel without evidence for a carrier-mediated mechanism. ; active borate transmembrane transporter activity : Enables the transport of borate across a membrane against the concentration gradient. ; sodium ion transport : The directed movement of sodium ions (Na+) into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; water transport : The directed movement of water (H2O) into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; bicarbonate transport : The directed movement of bicarbonate into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; cellular cation homeostasis : Any process involved in the maintenance of an internal steady state of cations at the level of a cell. ; borate transmembrane transport : The process in which borate is transported across a membrane. Borate is the anion (BO3)3-; boron is a group 13 element, with properties which are borderline between metals and non-metals. ; fluid transport : The directed movement of substances that are in liquid form in normal living conditions into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; borate transport : The directed movement of borate into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. Borate is the anion (BO3)3-; boron is a group 13 element, with properties which are borderline between metals and non-metals. ; inorganic anion transport : The directed movement of inorganic anions into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. Inorganic anions are atoms or small molecules with a negative charge which do not contain carbon in covalent linkage. ;


Symbol
SLC4A11
Name
solute carrier family 4 member 11
Entrez ID
83959
Ensembl ID
ENSG00000088836    (more details)
KEGG ID
hsa:83959    (more details)
OMIM ID
217400
Uniprot ID
Q8NBS3  
GO ID
hsa:83959    (more details)
Chromosome
5
Strand
-1
Start
136028988
End
136063818
miRNA Interactions
hsa-miR-133a-3p (RPM: 411.6588) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-429 (RPM: 100.5032) / hsa-miR-194-5p (RPM: 48.9448) / hsa-miR-126-3p (RPM: 494.5936) /
Involved Diseases
Posterior capsule opacification (PCO) /
Involved Pathways
Amyloid fiber formation /
Sequence
ATGGCCGCGGCCACCAGGCGCGTGTTCCATCTGCAGCCGTGCGAAAACTCTCCCACCATGTCGCAGAATGGATACTTCGAGGATTCAAGCTACTACAAGTGTGACACAGATGACACCTTCGAAGCCCGAGAGGAGATCCTGGGGGATGAGGCCTTCGACACTGCCAACTCCTCCATCGTGTCTGGCGAGAGTATCCGTTTTTTTGTCAATGTCAACCTTGAGATGCAGGCCACCAACACTGAGAATGAAGCGACTTCCGGTGGCTGTGTGCTCCTGCACACCTCCCGAAAGTACCTGAAGTTAAAGAACTTCAAGGAAGAGATCCGTGCGCACCGCGACCTAGATGGCTTCCTGGCGCAGGCCAGCATCGTCCTGAACGAGACGGCCACCTCCCTGGATAACGTGCTGCGGACCATGCTTCGCCGCTTCGCCAGGGACCCTGACAACAATGAGCCCAACTGCAACCTGGACCTGCTCATGGCCATGCTCTTCACCGATGCCGGGGCACCCATGCGGGGTAAAGTCCACCTGCTGTCAGATACCATCCAAGGGGTCACCGCCACAGTGACAGGGGTGCGGTACCAGCAGTCGTGGCTCTGCATCATCTGTACCATGAAGGCCCTACAGAAGCGGCACGTGTGCATCAGCCGCCTGGTTCGCCCACAGAACTGGGGGGAGAATTCCTGTGAGGTTCGGTTCGTCATCCTGGTGCTGGCCCCACCCAAGATGAAAAGCACTAAGACTGCGATGGAGGTGGCGCGCACGTTTGCCACCATGTTCTCGGATATCGCCTTCCGCCAGAAGCTCCTGGAGACCCGCACAGAGGAGGAATTCAAGGAGGCCTTGGTGCATCAGAGACAGCTGCTCACCATGGTGAGCCACGGTCCAGTGGCGCCGAGAACGAAGGAACGCAGCACAGTCTCCCTCCCTGCCCACAGACACCCAGAGCCCCCAAAGTGCAAGGACTTTGTCCCTTTTGGGAAGGGCATCCGGGAGGACATCGCACGCAGGTTCCCCTTGTACCCCTTGGACTTCACTGATGGCATTATTGGGAAAAACAAGGCTGTGGGCAAATACATCACCACCACCCTGTTCCTCTACTTCGCCTGCCTCCTGCCCACCATCGCTTTCGGGTCTCTCAATGACGAGAACACAGACGGGGCCATCGACGTGCAGAAGACCATAGCCGGGCAGAGCATCGGGGGCCTGCTCTACGCGCTCTTCTCTGGGCAGCCATTGGTGATTCTGCTGACCACCGCGCCCCTGGCGCTCTACATCCAGGTGATTCGTGTCATCTGTGATGACTATGACCTGGACTTCAACTCCTTCTACGCATGGACGGGCCTGTGGAATAGTTTCTTCCTTGCGCTTTATGCCTTTTTCAACCTCAGCCTGGTCATGAGTCTCTTCAAGAGGTCGACGGAGGAGATCATCGCCCTCTTCATTTCCATCACGTTTGTGCTGGATGCCGTCAAGGGCACGGTTAAAATCTTCTGGAAGTACTACTATGGGCATTACTTGGACGACTATCACACAAAAAGGACTTCATCCCTTGTCAGCCTGTCAGGCCTCGGCGCCAGCCTCAACGCCAGCCTCCACACTGCCCTCAACGCCAGCTTCCTCGCCAGCCCCACGGAGCTGCCCTCGGCCACACACTCAGGCCAGGCGACCGCCGTGCTCAGCCTCCTCATCATGCTGGGCACGCTCTGGCTGGGCTACACCCTCTACCAATTCAAGAAGAGCCCCTACCTGCACCCCTGCGTGCGAGAGATCCTGTCCGACTGCGCCCTGCCCATCGCGGTGCTCGCCTTCTCCCTCATCAGCTCCCATGGCTTCCGGGAAATCGAGATGAGCAAGTTCCGCTACAACCCCAGCGAGAGCCCCTTTGCGATGGCGCAGATCCAGTCGCTGTCCCTGAGGGCCGTCAGCGGTGCCATGGGCCTCGGCTTCCTGCTGTCCATGCTCTTCTTCATCGAGCAGAACTTGGTGGCCGCCTTGGTGAATGCACCGGAGAACAGGCTGGTGAAGGGCACTGCCTACCACTGGGACCTCCTGCTCCTCGCCATCATCAACACAGGGCTGTCTCTGTTTGGGCTGCCTTGGATCCATGCCGCCTACCCCCACTCCCCGCTGCACGTGCGAGCCCTGGCCTTAGTGGAGGAGCGTGTGGAGAACGGACACATCTATGACACGATTGTGAACGTGAAGGAGACGCGGCTGACCTCGCTGGGCGCCAGCGTCCTGGTGGGCCTGTCCCTGTTGCTGCTGCCGGTCCCGCTTCAGTGGATCCCCAAGCCCGTGCTCTATGGCCTCTTCCTCTACATCGCGCTCACCTCCCTCGATGGCAACCAGCTCGTCCAGCGCGTGGCCCTGCTGCTCAAGGAGCAGACTGCGTACCCCCCGACACACTACATCCGGAGGGTGCCCCAGAGGAAGATCCACTACTTCACGGGCCTGCAGGTGCTTCAGCTGCTGCTGCTGTGTGCCTTCGGCATGAGCTCCCTGCCCTACATGAAGATGATCTTTCCCCTCATCATGATCGCCATGATCCCCATCCGCTATATCCTGCTGCCCCGAATCATTGAAGCCAAGTACTTGGATGTCATGGACGCTGAGCACAGGCCTTGA

Back to List