Details for gene: CX3CR1


G protein-coupled receptor signaling pathway : A series of molecular signals that proceeds with an activated receptor promoting the exchange of GDP for GTP on the alpha-subunit of an associated heterotrimeric G-protein complex. The GTP-bound activated alpha-G-protein then dissociates from the beta- and gamma-subunits to further transmit the signal within the cell. The pathway begins with receptor-ligand interaction, or for basal GPCR signaling the pathway begins with the receptor activating its G protein in the absence of an agonist, and ends with regulation of a downstream cellular process, e.g. transcription. The pathway can start from the plasma membrane, Golgi or nuclear membrane. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; chemotaxis : The directed movement of a motile cell or organism, or the directed growth of a cell guided by a specific chemical concentration gradient. Movement may be towards a higher concentration (positive chemotaxis) or towards a lower concentration (negative chemotaxis). ; G protein-coupled receptor activity : Combining with an extracellular signal and transmitting the signal across the membrane by activating an associated G-protein; promotes the exchange of GDP for GTP on the alpha subunit of a heterotrimeric G-protein complex. ; cell adhesion : The attachment of a cell, either to another cell or to an underlying substrate such as the extracellular matrix, via cell adhesion molecules. ; C-X3-C chemokine receptor activity : Combining with a C-X3-C chemokine and transmitting the signal from one side of the membrane to the other to initiate a change in cell activity. A C-X3-C chemokine has three amino acids between the first two cysteines of the characteristic four-cysteine motif. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; signal transduction : The cellular process in which a signal is conveyed to trigger a change in the activity or state of a cell. Signal transduction begins with reception of a signal (e.g. a ligand binding to a receptor or receptor activation by a stimulus such as light), or for signal transduction in the absence of ligand, signal-withdrawal or the activity of a constitutively active receptor. Signal transduction ends with regulation of a downstream cellular process, e.g. regulation of transcription or regulation of a metabolic process. Signal transduction covers signaling from receptors located on the surface of the cell and signaling via molecules located within the cell. For signaling between cells, signal transduction is restricted to events at and within the receiving cell. ; immune system process : Any process involved in the development or functioning of the immune system, an organismal system for calibrated responses to potential internal or invasive threats. ; innate immune response : Innate immune responses are defense responses mediated by germline encoded components that directly recognize components of potential pathogens. ; immune response : Any immune system process that functions in the calibrated response of an organism to a potential internal or invasive threat. ; adaptive immune response : An immune response mediated by cells expressing specific receptors for antigen produced through a somatic diversification process, and allowing for an enhanced secondary response to subsequent exposures to the same antigen (immunological memory). ; inflammatory response : The immediate defensive reaction (by vertebrate tissue) to infection or injury caused by chemical or physical agents. The process is characterized by local vasodilation, extravasation of plasma into intercellular spaces and accumulation of white blood cells and macrophages. ; external side of plasma membrane : The leaflet of the plasma membrane that faces away from the cytoplasm and any proteins embedded or anchored in it or attached to its surface. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; integral component of plasma membrane : The component of the plasma membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; positive regulation of NF-kappaB transcription factor activity : Any process that activates or increases the frequency, rate or extent of activity of the transcription factor NF-kappaB. ; cellular response to lipopolysaccharide : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a lipopolysaccharide stimulus; lipopolysaccharide is a major component of the cell wall of gram-negative bacteria. ; cell surface : The external part of the cell wall and/or plasma membrane. ; response to wounding : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating damage to the organism. ; neuron projection : A prolongation or process extending from a nerve cell, e.g. an axon or dendrite. ; chemokine receptor activity : Combining with a chemokine, and transmitting the signal from one side of the membrane to the other to initiate a change in cell activity. Chemokines are a family of small chemotactic cytokines; their name is derived from their ability to induce directed chemotaxis in nearby responsive cells. All chemokines possess a number of conserved cysteine residues involved in intramolecular disulfide bond formation. Some chemokines are considered pro-inflammatory and can be induced during an immune response to recruit cells of the immune system to a site of infection, while others are considered homeostatic and are involved in controlling the migration of cells during normal processes of tissue maintenance or development. Chemokines are found in all vertebrates, some viruses and some bacteria. ; C-C chemokine receptor activity : Combining with a C-C chemokine and transmitting the signal from one side of the membrane to the other to initiate a change in cell activity. C-C chemokines do not have an amino acid between the first two cysteines of the characteristic four-cysteine motif. ; C-C chemokine binding : Interacting selectively and non-covalently with a C-C chemokine; C-C chemokines do not have an amino acid between the first two cysteines of the characteristic four-cysteine motif. ; positive regulation of cytosolic calcium ion concentration : Any process that increases the concentration of calcium ions in the cytosol. ; calcium-mediated signaling : Any intracellular signal transduction in which the signal is passed on within the cell via calcium ions. ; cell chemotaxis : The directed movement of a motile cell guided by a specific chemical concentration gradient. Movement may be towards a higher concentration (positive chemotaxis) or towards a lower concentration (negative chemotaxis). ; brain development : The process whose specific outcome is the progression of the brain over time, from its formation to the mature structure. Brain development begins with patterning events in the neural tube and ends with the mature structure that is the center of thought and emotion. The brain is responsible for the coordination and control of bodily activities and the interpretation of information from the senses (sight, hearing, smell, etc.). ; modulation of chemical synaptic transmission : Any process that modulates the frequency or amplitude of synaptic transmission, the process of communication from a neuron to a target (neuron, muscle, or secretory cell) across a synapse. Amplitude, in this case, refers to the change in postsynaptic membrane potential due to a single instance of synaptic transmission. ; regulation of synaptic plasticity : A process that modulates synaptic plasticity, the ability of synapses to change as circumstances require. They may alter function, such as increasing or decreasing their sensitivity, or they may increase or decrease in actual numbers. ; cellular defense response : A defense response that is mediated by cells. ; microglial cell activation involved in immune response : The change in morphology and behavior of a microglial cell resulting from exposure to a cytokine, chemokine, cellular ligand, or soluble factor, leading to the initiation or perpetuation of an immune response. ; regulation of nitric oxide biosynthetic process : Any process that modulates the frequency, rate or extent of the chemical reactions and pathways resulting in the formation of nitric oxide. ; positive regulation of protein kinase B signaling : Any process that activates or increases the frequency, rate or extent of protein kinase B signaling, a series of reactions mediated by the intracellular serine/threonine kinase protein kinase B. ; response to ischemia : Any process that results in a change in state or activity of an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a inadequate blood supply. ; perinuclear region of cytoplasm : Cytoplasm situated near, or occurring around, the nucleus. ; antifungal innate immune response : An defense response against a fungus mediated through an innate immune response. An innate immune response is mediated by germline encoded components that directly recognize components of potential pathogens. ; positive regulation of I-kappaB phosphorylation : Any process that activates or increases the frequency, rate or extent of I-kappaB phosphorylation. ; negative regulation of apoptotic signaling pathway : Any process that stops, prevents or reduces the frequency, rate or extent of apoptotic signaling pathway. ; positive regulation of neurogenesis : Any process that activates or increases the frequency, rate or extent of neurogenesis, the generation of cells within the nervous system. ; regulation of neurogenesis : Any process that modulates the frequency, rate or extent of neurogenesis, the generation of cells in the nervous system. ; synapse pruning : A cellular process that results in the controlled breakdown of synapse. After it starts the process is continuous until the synapse has disappeared. ; leukocyte chemotaxis : The movement of a leukocyte in response to an external stimulus. ; negative regulation of interleukin-1 beta production : Any process that stops, prevents, or reduces the frequency, rate, or extent of interleukin-1 beta production. ; C-X3-C chemokine binding : Interacting selectively and non-covalently with a C-X3-C chemokine; C-X3-C chemokines have three amino acids between the first two cysteines of the characteristic four-cysteine motif. ; neuronal cell body membrane : The plasma membrane of a neuron cell body - excludes the plasma membrane of cell projections such as axons and dendrites. ; cell-cell signaling : Any process that mediates the transfer of information from one cell to another. This process includes signal transduction in the receiving cell and, where applicable, release of a ligand and any processes that actively facilitate its transport and presentation to the receiving cell. Examples include signaling via soluble ligands, via cell adhesion molecules and via gap junctions. ; cytokine receptor activity : Combining with a cytokine and transmitting the signal from one side of the membrane to the other to initiate a change in cell activity. ; G protein-coupled peptide receptor activity : Combining with a peptide and transmitting the signal across the membrane by activating an associated G-protein; promotes the exchange of GDP for GTP on the alpha subunit of a heterotrimeric G-protein complex. ; CX3C chemokine receptor binding : Interacting selectively and non-covalently with a CX3C chemokine receptor. ; positive regulation of neuroblast proliferation : Any process that activates or increases the rate of neuroblast proliferation. ; phospholipase C-activating G protein-coupled receptor signaling pathway : The series of molecular signals generated as a consequence of a G protein-coupled receptor binding to its physiological ligand, where the pathway proceeds with activation of phospholipase C (PLC) and a subsequent increase in the concentration of inositol trisphosphate (IP3) and diacylglycerol (DAG). ; memory : The activities involved in the mental information processing system that receives (registers), modifies, stores, and retrieves informational stimuli. The main stages involved in the formation and retrieval of memory are encoding (processing of received information by acquisition), storage (building a permanent record of received information as a result of consolidation) and retrieval (calling back the stored information and use it in a suitable way to execute a given task). ; central nervous system maturation : A developmental process, independent of morphogenetic (shape) change, that is required for the central nervous system to attain its fully functional state. The central nervous system is the core nervous system that serves an integrating and coordinating function. In vertebrates it consists of the brain and spinal cord. In those invertebrates with a central nervous system it typically consists of a brain, cerebral ganglia and a nerve cord. ; negative regulation of cell migration : Any process that stops, prevents, or reduces the frequency, rate or extent of cell migration. ; regulation of tumor necrosis factor production : Any process that modulates the frequency, rate or extent of tumor necrosis factor production. ; social behavior : Behavior directed towards society, or taking place between members of the same species. Occurs predominantly, or only, in individuals that are part of a group. ; autocrine signaling : Signaling between cells of the same type. The signal produced by the signaling cell binds to a receptor on, and affects a cell of the same type. ; positive regulation of angiogenesis : Any process that activates or increases angiogenesis. ; host-mediated regulation of intestinal microbiota composition : The biological process involved in maintaining the steady-state number of cells within a population of free-living cells such as the bacteria in the gut. ; leukocyte tethering or rolling : Transient adhesive interactions between leukocytes and endothelial cells lining blood vessels. Carbohydrates on circulating leukocytes bind selectins on the vessel wall causing the leukocytes to slow down and roll along the inner surface of the vessel wall. During this rolling motion, transitory bonds are formed and broken between selectins and their ligands. Typically the first step in cellular extravasation (the movement of leukocytes out of the circulatory system, towards the site of tissue damage or infection). ; synapse maturation : The process that organizes a synapse so that it attains its fully functional state. Synaptic maturation plays a critical role in the establishment of effective synaptic connections in early development. ; chemokine-mediated signaling pathway : A series of molecular signals initiated by the binding of a chemokine to a receptor on the surface of a cell, and ending with regulation of a downstream cellular process, e.g. transcription. ; cellular response to transforming growth factor beta stimulus : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a transforming growth factor beta stimulus. ; positive regulation of monocyte chemotaxis : Any process that increases the frequency, rate, or extent of monocyte chemotaxis. ; negative regulation of hippocampal neuron apoptotic process : Any process that stops, prevents, or reduces the frequency, rate or extent of cell death by apoptotic process in hippocampal neurons. ; multiple spine synapse organization, single dendrite : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of a synapse between a multiple synapse bouton and a single dendrite. ; negative regulation of long-term synaptic potentiation : Any process that stops, prevents or reduces the frequency, rate or extent of long-term synaptic potentiation. ; regulation of microglial cell migration : Any process that modulates the frequency, rate or extent of microglial cell migration. ; positive regulation of microglial cell migration : Any process that activates or increases the frequency, rate or extent of microglial cell migration. ; negative regulation of microglial cell mediated cytotoxicity : Any process that stops, prevents or reduces the frequency, rate or extent of microglial cell mediated cytotoxicity. ; dendritic tree : The entire complement of dendrites for a neuron, consisting of each primary dendrite and all its branches. ;


Symbol
CX3CR1
Name
C-X3-C motif chemokine receptor 1
Entrez ID
1524
Ensembl ID
ENSG00000168329    (more details)
KEGG ID
hsa:1524    (more details)
OMIM ID
601470
Uniprot ID
P49238  
GO ID
hsa:1524    (more details)
Chromosome
20
Strand
-1
Start
23626706
End
23638473
miRNA Interactions
hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-148b-3p (RPM: 970.7614) / hsa-miR-330-3p (RPM: 21.3424) / hsa-miR-296-3p (RPM: 8.5012) / hsa-miR-99b-5p (RPM: 14318.7458) /
Involved Diseases
Age-related macular degeneration (AMD) /
Involved Pathways
Salivary secretion /
Sequence
ATGGATCAGTTCCCTGAATCAGTGACAGAAAACTTTGAGTACGATGATTTGGCTGAGGCCTGTTATATTGGGGACATCGTGGTCTTTGGGACTGTGTTCCTGTCCATATTCTACTCCGTCATCTTTGCCATTGGCCTGGTGGGAAATTTGTTGGTAGTGTTTGCCCTCACCAACAGCAAGAAGCCCAAGAGTGTCACCGACATTTACCTCCTGAACCTGGCCTTGTCTGATCTGCTGTTTGTAGCCACTTTGCCCTTCTGGACTCACTATTTGATAAATGAAAAGGGCCTCCACAATGCCATGTGCAAATTCACTACCGCCTTCTTCTTCATCGGCTTTTTTGGAAGCATATTCTTCATCACCGTCATCAGCATTGATAGGTACCTGGCCATCGTCCTGGCCGCCAACTCCATGAACAACCGGACCGTGCAGCATGGCGTCACCATCAGCCTAGGCGTCTGGGCAGCAGCCATTTTGGTGGCAGCACCCCAGTTCATGTTCACAAAGCAGAAAGAAAATGAATGCCTTGGTGACTACCCCGAGGTCCTCCAGGAAATCTGGCCCGTGCTCCGCAATGTGGAAACAAATTTTCTTGGCTTCCTACTCCCCCTGCTCATTATGAGTTATTGCTACTTCAGAATCATCCAGACGCTGTTTTCCTGCAAGAACCACAAGAAAGCCAAAGCCATTAAACTGATCCTTCTGGTGGTCATCGTGTTTTTCCTCTTCTGGACACCCTACAACGTTATGATTTTCCTGGAGACGCTTAAGCTCTATGACTTCTTTCCCAGTTGTGACATGAGGAAGGATCTGAGGCTGGCCCTCAGTGTGACTGAGACGGTTGCATTTAGCCATTGTTGCCTGAATCCTCTCATCTATGCATTTGCTGGGGAGAAGTTCAGAAGATACCTTTACCACCTGTATGGGAAATGCCTGGCTGTCCTGTGTGGGCGCTCAGTCCACGTTGATTTCTCCTCATCTGAATCACAAAGGAGCAGGCATGGAAGTGTTCTGAGCAGCAATTTTACTTACCACACGAGTGATGGAGATGCATTGCTCCTTCTCTGA

Back to List