Details for gene: HLA-DRB4


membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; immune response : Any immune system process that functions in the calibrated response of an organism to a potential internal or invasive threat. ; antigen processing and presentation : The process in which an antigen-presenting cell expresses antigen (peptide or lipid) on its cell surface in association with an MHC protein complex. ; MHC class II protein complex : A transmembrane protein complex composed of an MHC class II alpha and MHC class II beta chain, and with or without a bound peptide or polysaccharide antigen. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; endoplasmic reticulum : The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached). ; endoplasmic reticulum membrane : The lipid bilayer surrounding the endoplasmic reticulum. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; Golgi apparatus : A membrane-bound cytoplasmic organelle of the endomembrane system that further processes the core oligosaccharides (e.g. N-glycans) added to proteins in the endoplasmic reticulum and packages them into membrane-bound vesicles. The Golgi apparatus operates at the intersection of the secretory, lysosomal, and endocytic pathways. ; endosome : A vacuole to which materials ingested by endocytosis are delivered. ; lysosomal membrane : The lipid bilayer surrounding the lysosome and separating its contents from the cell cytoplasm. ; endosome membrane : The lipid bilayer surrounding an endosome. ; lysosome : A small lytic vacuole that has cell cycle-independent morphology and is found in most animal cells and that contains a variety of hydrolases, most of which have their maximal activities in the pH range 5-6. The contained enzymes display latency if properly isolated. About 40 different lysosomal hydrolases are known and lysosomes have a great variety of morphologies and functions. ; immune system process : Any process involved in the development or functioning of the immune system, an organismal system for calibrated responses to potential internal or invasive threats. ; adaptive immune response : An immune response mediated by cells expressing specific receptors for antigen produced through a somatic diversification process, and allowing for an enhanced secondary response to subsequent exposures to the same antigen (immunological memory). ; late endosome membrane : The lipid bilayer surrounding a late endosome. ; antigen processing and presentation of peptide or polysaccharide antigen via MHC class II : The process in which an antigen-presenting cell expresses antigen (peptide or polysaccharide) on its cell surface in association with an MHC class II protein complex. ; MHC class II protein complex binding : Interacting selectively and non-covalently with the class II major histocompatibility complex. ; peptide antigen assembly with MHC class II protein complex : The binding of a peptide to the antigen binding groove of an MHC class II protein complex. ; antigen processing and presentation of exogenous peptide antigen via MHC class II : The process in which an antigen-presenting cell expresses a peptide antigen of exogenous origin on its cell surface in association with an MHC class II protein complex. The peptide antigen is typically, but not always, processed from a whole protein. ; positive regulation of T cell activation : Any process that activates or increases the frequency, rate or extent of T cell activation. ; trans-Golgi network membrane : The lipid bilayer surrounding any of the compartments that make up the trans-Golgi network. ; Golgi membrane : The lipid bilayer surrounding any of the compartments of the Golgi apparatus. ; endocytic vesicle membrane : The lipid bilayer surrounding an endocytic vesicle. ; ER to Golgi transport vesicle membrane : The lipid bilayer surrounding a vesicle transporting substances from the endoplasmic reticulum to the Golgi. ; clathrin-coated endocytic vesicle membrane : The lipid bilayer surrounding a clathrin-coated endocytic vesicle. ; integral component of lumenal side of endoplasmic reticulum membrane : The component of the endoplasmic reticulum membrane consisting of the gene products that penetrate only the lumenal side of the membrane. ; transport vesicle membrane : The lipid bilayer surrounding a transport vesicle. ;


Symbol
HLA-DRB4
Name
major histocompatibility complex, class II, DR beta 4
Entrez ID
3126
Ensembl ID
ENSG00000231021    (more details)
KEGG ID
hsa:3126    (more details)
OMIM ID
FALSE
Uniprot ID
P13762  
GO ID
hsa:3126    (more details)
Chromosome
6
Strand
-1
Start
32578769
End
32589848
miRNA Interactions
hsa-miR-126-3p (RPM: 494.5936) /
Involved Diseases
Vogt-Koyanagi-Harada disease /
Involved Pathways
Hematopoietic cell lineage / Type I diabetes mellitus / Cell adhesion molecules (CAMs) / Phagosome / Antigen processing and presentation / Intestinal immune network for IgA production /
Sequence
ATGGTGTGTCTGAAGCTCCCTGGAGGCTCCTGTATGGCAGCGCTGACAGTGACATTGACGGTGCTGAGCTCCCCACTGGCTTTGGCTGGGGACACCCAACCACGTTTCTTGGAGCAGGCTAAGTGTGAGTGTCATTTCCTCAATGGGACGGAGCGAGTGTGGAACCTGATCAGATACATCTATAACCAAGAGGAGTACGCGCGCTACAACAGTGACCTGGGGGAGTACCAGGCGGTGACGGAGCTGGGGCGGCCTGACGCTGAGTACTGGAACAGCCAGAAGGACCTCCTGGAGCGGAGGCGGGCCGAGGTGGACACCTACTGCAGATACAACTACGGGGTTGTGGAGAGCTTCACAGTGCAGCGGCGAGTCCAACCTAAGGTGACTGTGTATCCTTCAAAGACCCAGCCCCTGCAGCACCACAACCTCCTGGTCTGCTCTGTGAATGGTTTCTATCCAGGCAGCATTGAAGTCAGGTGGTTCCGGAACGGCCAGGAAGAGAAGGCTGGGGTGGTGTCCACAGGCCTGATCCAGAATGGAGACTGGACCTTCCAGACCCTGGTGATGCTGGAAACAGTTCCTCGGAGTGGAGAGGTTTACACCTGCCAAGTGGAGCATCCAAGCATGATGAGCCCTCTCACGGTGCAATGGAGTGCACGGTCTGAATCTGCACAGAGCAAGATGCTGAGTGGAGTCGGGGGCTTTGTGCTGGGCCTGCTCTTCCTTGGGACAGGGCTGTTCATCTACTTCAGGAATCAGAAAGGACACTCTGGACTTCAGCCAACAGGACTCTTGAGCTGA

Back to List