Details for gene: CHN1


signal transduction : The cellular process in which a signal is conveyed to trigger a change in the activity or state of a cell. Signal transduction begins with reception of a signal (e.g. a ligand binding to a receptor or receptor activation by a stimulus such as light), or for signal transduction in the absence of ligand, signal-withdrawal or the activity of a constitutively active receptor. Signal transduction ends with regulation of a downstream cellular process, e.g. regulation of transcription or regulation of a metabolic process. Signal transduction covers signaling from receptors located on the surface of the cell and signaling via molecules located within the cell. For signaling between cells, signal transduction is restricted to events at and within the receiving cell. ; GTPase activator activity : Binds to and increases the activity of a GTPase, an enzyme that catalyzes the hydrolysis of GTP. ; intracellular signal transduction : The process in which a signal is passed on to downstream components within the cell, which become activated themselves to further propagate the signal and finally trigger a change in the function or state of the cell. ; positive regulation of GTPase activity : Any process that activates or increases the activity of a GTPase. ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; nervous system development : The process whose specific outcome is the progression of nervous tissue over time, from its formation to its mature state. ; regulation of small GTPase mediated signal transduction : Any process that modulates the frequency, rate or extent of small GTPase mediated signal transduction. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; regulation of GTPase activity : Any process that modulates the rate of GTP hydrolysis by a GTPase. ; ephrin receptor signaling pathway : The series of molecular signals generated as a consequence of an ephrin receptor binding to an ephrin. ; regulation of axonogenesis : Any process that modulates the frequency, rate or extent of axonogenesis, the generation of an axon, the long process of a neuron. ; ephrin receptor binding : Interacting selectively and non-covalently with an ephrin receptor. ; motor neuron axon guidance : The process in which the migration of an axon growth cone of a motor neuron is directed to a specific target site in response to a combination of attractive and repulsive cues. ;


Symbol
CHN1
Name
chimerin 1
Entrez ID
1123
Ensembl ID
ENSG00000128656    (more details)
KEGG ID
hsa:1123    (more details)
OMIM ID
118423
Uniprot ID
P15882  
GO ID
hsa:1123    (more details)
Chromosome
6
Strand
-1
Start
32611143
End
32626106
miRNA Interactions
hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-205-5p (RPM: 5027.3352) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-92a-3p (RPM: 16961.15) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-1301-3p (RPM: 47.2112) / hsa-miR-202-5p (RPM: 0.3964) / hsa-miR-548b-3p (RPM: 0.1786) / hsa-miR-193b-5p (RPM: 3.2336) /
Involved Diseases
Strabismus /
Involved Pathways
Viral myocarditis /
Sequence
ATGGCCCTGACCCTGTTTGATACAGATGAATATAGACCTCCTGTTTGGAAATCTTACTTATATCAGCTACAACAGGAAGCCCCTCATCCTCGAAGAATTACCTGTACTTGCGAGGTGGAAAACAGACCAAAGTATTATGGAAGAGAGTTTCATGGCATGATCTCCAGAGAAGCAGCCGACCAGCTCTTGATTGTGGCTGAGGGGAGCTACCTCATCCGGGAGAGCCAGCGGCAGCCAGGGACCTACACTTTGGCTTTAAGATTTGGAAGTCAAACCAGAAACTTCAGGCTCTACTACGATGGCAAGCACTTTGTTGGGGAGAAACGCTTTGAGTCCATCCACGATCTGGTGACTGATGGCTTGATTACTCTCTATATTGAAACCAAGGCAGCAGAATACATTGCCAAGATGACGATAAACCCAATTTATGAGCACGTAGGATACACAACCTTAAACAGAGAGCCAGCATACAAAAAACATATGCCAGTCCTGAAAGAGACACATGATGAGAGAGATTCTACAGGCCAGGATGGGGTGTCAGAGAAAAGGTTGACATCACTTGTTAGAAGAGCAACTCTGAAAGAAAACGAGCAAATTCCAAAATATGAAAAGATTCACAATTTCAAGGTGCATACATTCAGAGGGCCACACTGGTGTGAATACTGTGCCAACTTTATGTGGGGTCTCATTGCTCAGGGAGTGAAATGTGCAGATTGTGGTTTGAATGTTCATAAGCAGTGTTCCAAGATGGTCCCAAATGACTGTAAGCCAGACTTGAAGCATGTCAAAAAGGTGTACAGCTGTGACCTTACGACGCTCGTGAAAGCACATACCACTAAGCGGCCAATGGTGGTAGACATGTGCATCAGGGAGATTGAGTCTAGAGGTCTTAATTCTGAAGGACTATACCGAGTATCAGGATTTAGTGACCTAATTGAAGATGTCAAGATGGCTTTCGACAGAGATGGTGAGAAGGCAGATATTTCTGTGAACATGTATGAAGATATCAACATTATCACTGGTGCACTTAAACTGTACTTCAGGGATTTGCCAATTCCACTCATTACATATGATGCCTACCCTAAGTTTATAGAATCTGCCAAAATTATGGATCCGGATGAGCAATTGGAAACCCTTCATGAAGCACTGAAACTACTGCCACCTGCTCACTGCGAAACCCTCCGGTACCTCATGGCACATCTAAAGAGAGTGACCCTCCACGAAAAGGAGAATCTTATGAATGCAGAGAACCTTGGAATCGTCTTTGGACCCACCCTTATGAGATCTCCAGAACTAGACGCCATGGCTGCATTGAATGATATACGGTATCAGAGACTGGTGGTGGAGCTGCTTATCAAAAACGAAGACATTTTATTTTAA

Back to List