Details for gene: TUBA3D


GTP binding : Interacting selectively and non-covalently with GTP, guanosine triphosphate. ; microtubule-based process : Any cellular process that depends upon or alters the microtubule cytoskeleton, that part of the cytoskeleton comprising microtubules and their associated proteins. ; microtubule : Any of the long, generally straight, hollow tubes of internal diameter 12-15 nm and external diameter 24 nm found in a wide variety of eukaryotic cells; each consists (usually) of 13 protofilaments of polymeric tubulin, staggered in such a manner that the tubulin monomers are arranged in a helical pattern on the microtubular surface, and with the alpha/beta axes of the tubulin subunits parallel to the long axis of the tubule; exist in equilibrium with pool of tubulin monomers and can be rapidly assembled or disassembled in response to physiological stimuli; concerned with force generation, e.g. in the spindle. ; GTPase activity : Catalysis of the reaction: GTP + H2O = GDP + phosphate. ; structural constituent of cytoskeleton : The action of a molecule that contributes to the structural integrity of a cytoskeletal structure. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; nucleotide binding : Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose. ; cytoskeleton : Any of the various filamentous elements that form the internal framework of cells, and typically remain after treatment of the cells with mild detergent to remove membrane constituents and soluble components of the cytoplasm. The term embraces intermediate filaments, microfilaments, microtubules, the microtrabecular lattice, and other structures characterized by a polymeric filamentous nature and long-range order within the cell. The various elements of the cytoskeleton not only serve in the maintenance of cellular shape but also have roles in other cellular functions, including cellular movement, cell division, endocytosis, and movement of organelles. ; microtubule cytoskeleton : The part of the cytoskeleton (the internal framework of a cell) composed of microtubules and associated proteins. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; cytoskeleton organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of cytoskeletal structures. ; microtubule cytoskeleton organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of cytoskeletal structures comprising microtubules and their associated proteins. ; mitotic cell cycle : Progression through the phases of the mitotic cell cycle, the most common eukaryotic cell cycle, which canonically comprises four successive phases called G1, S, G2, and M and includes replication of the genome and the subsequent segregation of chromosomes into daughter cells. In some variant cell cycles nuclear replication or nuclear division may not be followed by cell division, or G1 and G2 phases may be absent. ;


Symbol
TUBA3D
Name
tubulin alpha 3d
Entrez ID
113457
Ensembl ID
ENSG00000075886    (more details)
KEGG ID
hsa:113457    (more details)
OMIM ID
617878
Uniprot ID
Q13748  
GO ID
hsa:113457    (more details)
Chromosome
9
Strand
1
Start
136410641
End
136423761
miRNA Interactions
hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-429 (RPM: 100.5032) / hsa-miR-155-5p (RPM: 106.9134) /
Involved Diseases
Keratoconus /
Involved Pathways
Activation of anterior HOX genes in hindbrain development during early embryogenesis /
Sequence
ATGCGCGAGTGTATCTCTATCCACGTGGGGCAGGCGGGTGTCCAGATCGGCAATGCCTGCTGGGAACTGTACTGCCTTGAACATGGAATTCAGCCCGATGGCCAAATGCCAAGTGATAAAACCATTGGTGGCGGGGACGACTCCTTCAACACGTTCTTCAGTGAGACTGGAGCTGGCAAGCACGTGCCCAGAGCAGTGTTTGTGGACCTGGAGCCCACTGTGGTCGATGAAGTGCGCACAGGGACCTACAGGCAGCTCTTCCACCCGGAGCAGCTGATCACCGGGAAGGAAGATGCAGCCAATAATTACGCCAGGGGCCATTACACCATCGGCAAGGAGATTGTTGACCTAGTCCTGGACCGGATCCGCAAACTGGCGGATCTGTGCACAGGACTGCAGGGCTTCCTCATCTTCCACAGCTTTGGGGGCGGCACTGGCTCTGGGTTCGCATCTCTGCTCATGGAGCGGCTCTCAGTGGATTACGGCAAGAAGTCCAAGCTAGAGTTTGCCATTTACCCAGCCCCCCAGGTCTCCACAGCCGTGGTGGAGCCCTACAACTCCATCCTGACCACCCACACGACCCTGGAACATTCTGACTGTGCCTTCATGGTCGACAATGAAGCCATCTATGACATATGTCGGCGCAACCTGGACATTGAACGTCCCACGTACACCAACCTCAATCGCCTGATTGGGCAGATCGTGTCCTCCATCACAGCCTCCCTGCGATTTGATGGGGCCCTGAATGTGGACTTGACGGAATTCCAGACCAACCTAGTGCCGTACCCCCGCATCCACTTCCCCCTGGCCACCTATGCCCCAGTCATCTCAGCTGAGAAGGCCTACCACGAGCAGCTGTCTGTGGCCGAGATCACCAATGCCTGCTTCGAGCCAGCCAATCAAATGGTCAAGTGTGACCCTCGCCACGGCAAGTACATGGCCTGCTGCATGTTGTACAGGGGGGACGTGGTCCCCAAAGACGTCAACGCGGCCATCGCCACCATCAAGACCAAGCGCACCATCCAGTTTGTGGATTGGTGCCCGACTGGATTTAAGGTGGGCATTAACTACCAGCCCCCCACAGTGGTCCCCGGGGGAGACCTGGCCAAGGTGCAGCGGGCCGTGTGCATGCTGAGCAACACCACGGCCATTGCGGAGGCCTGGGCCCGCCTGGACCATAAGTTCGATCTCATGTATGCCAAGCGGGCCTTTGTGCACTGGTACGTGGGCGAAGGCATGGAAGAGGGAGAGTTCTCTGAGGCCCGCGAGGACCTGGCAGCTCTAGAGAAGGATTATGAAGAGGTGGGCGTGGATTCCGTGGAAGCTGAGGCTGAAGAAGGCGAAGAATACTGA

Back to List