Details for gene: ZNF469


nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; DNA binding : Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid). ;


Symbol
ZNF469
Name
zinc finger protein 469
Entrez ID
84627
Ensembl ID
ENSG00000225614    (more details)
KEGG ID
hsa:84627    (more details)
OMIM ID
229200
Uniprot ID
H3BS19  
GO ID
hsa:84627    (more details)
Chromosome
4
Strand
1
Start
120684919
End
120922870
miRNA Interactions
hsa-miR-29c-3p (RPM: 661.3514) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-4779 (RPM: 0.024) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-9-5p (RPM: 3525.806) / hsa-miR-186-5p (RPM: 1645.2832) / hsa-miR-520f-3p (RPM: 0.0042) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-671-5p (RPM: 10.1036) / hsa-miR-1292-5p (RPM: 0.815) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-151a-5p (RPM: 2651.1674) / hsa-miR-151b (RPM: 64.4104) / hsa-miR-27a-5p (RPM: 7.3838) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-10b-5p (RPM: 14052.6542) / hsa-miR-6726-5p (RPM: 0.0122) /
Involved Diseases
Keratoconus /
Involved Pathways
Pathogenic Escherichia coli infection / Phagosome / Gap junction /
Sequence
ATGCCTGGGGAGCGCCCCCGAGGAGCGCCGCCCCCCACCATGACTGGAGACCTGCAGCCCCGCCAAGTTGCCAGCAGCCCGGGGCACCCCTCCCAGCCGCCACTGGAGGACAACACCCCAGCTACCAGGACCACCAAGGGTGCCAGGGAGGCTGGCGGCCAGGCCCAGGCCATGGAGCTCCCCGAGGCCCAGCCAAGGCAGGCCAGGGACGGGGAGCTCAAGCCCCCATCCCTGAGAGGCCAGGCCCCGAGCAGCACCCCTGGGAAGAGGGGCAGCCCCCAGACCCCACCGGGGAGAAGCCCCTTGCAGGCTCCCTCAAGGCTGGCGGGCAGGGCAGAGGGCAGCCCCCCACAGCGCTACATTCTGGGCATCGCCAGCTCGAGGACCAAGCCCACCCTGGACGAGACACCAGAGAACCCACAGCTGGAGGCTGCCCAGCTCCCTGAGGTGGACACCCCCCAGGGCCCTGGGACTGGAGCTCCACTCAGGCCGGGCCTCCCAAGGACTGAGGCCCAACCCGCCGCCGAAGAGCTTGGCTTCCACAGGTGCTTCCAGGAGCCACCCTCCAGCTTTACCTCCACCAACTATACCTCACCAAGCGCCACCCCCAGGCCCCCAGCCCCGGGGCCCCCCCAGAGCAGGGGCACCAGCCCCCTCCAGCCCGGTTCCTATCCCGAATACCAGGCCAGTGGGGCCGACTCCTGGCCTCCCGCTGCTGAGAATAGCTTCCCAGGTGCTAATTTCGGGGTTCCCCCCGCCGAGCCGGAACCTATTCCCAAAGGCAGCAGGCCCGGCGGCAGCCCCAGGGGAGTTTCCTTCCAGTTCCCCTTCCCGGCACTGCATGGGGCCAGCACAAAACCCTTCCCTGCGGATGTGGCTGGGCACGCATTCACCAATGGGCCACTGGTGTTTGCCTTCCATCAGCCCCAGGGAGCGTGGCCGGAGGAGGCCGTGGGCACGGGCCCTGCCTACCCGCTGCCCACCCAGCCTGCGCCCTCACCCCTGCCCTGCTACCAGGGCCAGCCAGGTGGCCTGAACCGCCACAGCGACCTCAGTGGTGCCCTCTCTTCCCCTGGAGCTGCTCACTCGGCCCCGAGACCCTTCTCTGACAGTTTACACAAGAGCCTGACCAAAATCCTTCCCGAAAGACCACCTTCAGCCCAGGATGGGCTGGGGAGCACGAGAGGGCCCCCTAGCTCCCTACCCCAGAGGCACTTTCCAGGGCAGGCGTACAGAGCCAGTGGGGTGGACACCAGCCCGGGGCCTCCGGACACCGAGCTGGCCGCCCCAGGGCCCCCACCCGCCAGGCTGCCCCAGCTGTGGGACCCCACAGCAGCCCCTTACCCCACACCTCCTGGGGGCCCCCTGGCTGCCACCAGGAGTATGTTCTTTAACGGCCAGCCCAGCCCAGGCCAGCGGCTCTGCCTCCCCCAGAGTGCCCCCCTGCCTTGGCCCCAAGTGCTCCCGACCGCCCGGCCAAGTCCCCACGGAATGGAGATGCTGAGCCGGCTGCCTTTCCCCGCGGGGGGCCCCGAGTGGCAGGGGGGCAGCCAAGGAGCCCTGGGCACTGCTGGCAAGACACCGGGACCCAGAGAGAAGCTGCCAGCCGTGAGAAGCAGCCAGGGCGGCTCCCCAGCACTGTTCACCTACAACGGAATGACAGACCCTGGGGCTCAGCCCCTGTTCTTCGGGGTGGCCCAGCCCCAGGTTTCACCCCACGGGACACCCAGCCTGCCCCCACCGAGGGTAGTGGGAGCCTCCCCCAGCGAGTCCCCACTGCCGTCACCGGCCACCAACACGGCCGGCAGCACCTGCTCTTCCCTGTCGCCGATGTCCAGCAGCCCAGCCAACCCCAGCTCAGAGGAAAGCCAGCTCCCCGGCCCCCTCGGGCCCTCGGCCTTCTTCCACCCACCCACTCACCCCCAGGAGACGGGCAGCCCCTTCCCGTCCCCGGAGCCCCCCCACTCCCTCCCCACCCACTACCAGCCAGAGCCAGCCAAGGCCTTCCCTTTTCCCGCAGATGGGCTGGGAGCCGAGGGTGCCTTCCAGTGCCTGGAGGAGACCCCATTCCCCCACGAGGGCCCCGAGGTGGGTCGGGGAGGGCTGCAGGGCTTCCCCCGTGCGCCGCCTCCGTACCCCACACACCACTTCTCCCTCAGCAGCGCCAGCCTGGACCAGCTGGACGTGCTGCTGACCTGCAGGCAGTGTGACCGCAACTACAGCAGCCTGGCGGCCTTCCTGGCCCACCGGCAGTTCTGTGGCCTGCTCCTGGCCAGGGCCAAGGATGGCCACCAGCGGTCTCCAGGCCCCCCTGGGCTCCCCTCGCCCCCCGCTGCCCCCAGAGTCCCTGCCGACGCACACGCGGGCTTGCTCAGCCACGCGAAGACCTTCCTGTTAGCTGGGGACGCCCAGGCCGAGGGCAAAGACGACCCCCTGAGGACAGGCTTCCTGCCCAGCCTGGCCGCCACCCCCTTCCCGCTCCCTGCCTCGGACCTGGACATGGAGGATGACGCCAAGCTGGACAGCCTCATCACAGAGGCGCTCAACGGCATGGAGTACCAGTCGGACAACCCGGAGATCGACAGCAGCTTCATCGACGTCTTCGCGGACGAGGAGCCTTCCGGCCCCAGAGGTCCCAGCTCCGGACACCCCCTTAAGAGCAAGGCGGGGGTGACTCCAGAGAGCAAAGCTCCGCCCCCGCTCCCAGCAGCCACGCCGGACCCCCAAACCCCCCGCCCTGGGGACAGGGGCTGCCCAGCCCGAGGCAGGCCCAAAACGCGTTCCCTGGGTCTGGCCCCCACCGAGGCGGATGCGCCCAGCCAGGGCAGGCAGCAGAGGAGGGGGAAGCAGTTGAAGCTGTTCCGGAAGGATCTGGACTCGGGCGGCGCAGCAGAGGGGTCGGGGTCGGGCGGCGGCGGCAGAGCCTCCGGCCTGAGGCCCCGGAGGAACGACGGTCTCGGGGAGCGGCCCCCACCCCGTCCCCGGCGCCCTAGAACGCAGGCCCCCGGGAGCCGCGCAGACCCCGCGCCCCGGGTCCCGAGAGCCGCCGCCCTCCCCGAGGAGACCCGCAGCTCCCGGCGCCGCCGGCTGCCCCCCAGGAAGGACCCCAGGAAGAGGAAGGCTCGGGGCGGCGCCTGGGGCAAGGAGCTCATTCTGAAGATCGTGCAGCAGAAGAACAGGCGCCACCGGCGGCTGGGGCGGCGGGCGGGCAGGTGCGGCTCCCTGGCGGCGGGGAGGCCCCGGCCCGGAGCTGAGGACCGCAGGCTCCGCGAGTACGACTTCGCCTCGGAGTCCGAGGAGGACGAGCAGCCTCCGCCGCGGGGCCCCGGCTTCAGAGGCCGGCGGGGCCGAGGCGAGAAGAGGAAGGAAGTGGAGCTGACCCAGGGTCCCAGAGAGGATGAGCCACAGAAACCCCGGAAGGCGGCGAGGCAGGAAGCCGGCGGGGACGGAGCCCCCGCGAACCCCGAGGAGCCGGGCGGGTCTCGCCCGGGCCCCGGCAGGAGCCCTCAGGCCCGTGGCCCGTCTCGAAGCCTGGAGACGGGAGCGGCCGCCAGGGAGGGAGGCCCCAAGTGTGCTGATCGCCCCTCAGTGGCCCCCAAGGATCCCCTGCAGGTCCCCACCAACACCGAGACCTCAGAGGAAACCCGCCCGTCGCTGGACTTTCCCCAGGAGGCCAAGGAGCCTGAAACTGCCGAAGAGTCAGCCCCGGACAGCACAGAATTCACAGAGGCTTTGCGTTCTCCTCCAGCCGCCTGTGCGGGAGAAATGGGAGCAAGCCCCGGTCTCCTGATACCAGAGCAGCCGCCGCCCAGCAGACATGACACCGGCACCCCCAAGCCGTCGGGAAGCCTCGCCAACACGGCGCCCCACGGAAGCTCGCCAACGCCAGGTGTGGGCAGCCTGCTGGGTGGTCCTGGGGGCACACAGGCCCCAGTCTCCCACAACAGCAAGGACCCCCCTGCCCGCCAGCCTGGAGAATTTCTGGCACCCGTGGCTAACCCCTCAAGTACCGCCTGCCCCAAACCCAGTGTTCTGTCTTCAAAGATCTCCAGTTTTGGCTGTGACCCTGCTGGTTTTAACAGAGACCCCTTGGGGGTTCCAGTTGCCAAAAAGGGGCCTCAGCCCTACAGCAGCCCCCACAGTGAGTTGTTCCTCGGACCCAAAGACCTGGCTGGCTGTTTCCTGGAAGAACTGCACCCCAAGCCCTCAGCCAGGGATGCCCCGCCGGCCAGCAGCTCCTGCCTTTGCCAGGACGGCGAGGATGCCGGTTCCCTCGAGCCACAGCTGCCAAGGAGCCCACCTGGCACCGCTGAGACGGAGCCAGGCAGGGCTGCATCGCCACCGACCTTGGAGTCCTCATCCCTCTTCCCAGACCTGCCGGTGGACAGATTCGACCCACCCCTCTATGGCAGCCTGTCTGCGAACAGGGACTCCGGTCTGCCGTTCGCATGTGCCGACCCTCCCCAGAAGACGGTGCCGTCAGATCCACCGTACCCCTCTTTTTTGCTGCTTGAGGAAGTATCCCCGATGCTGCCTAGCCATTTTCCTGATCTCTCGGGGGGAAAGGTGCTCAGTAAGACGTGTCCCCCTGAACGGACAGTGGTTCCCGGCGCCGCCCCATCTTTGCCTGGGAAGGGGAGTGGATGTAGCGTTGCTCTTATGAGTCACCTGTCCGAGGATGAACTGGAGATCCAGAAATTGGTCACCGAATTAGAAAGTCAGCTGCAAAGGAGCAAAGACACACGTGGGGCCCCGAGAGAGCTTGCAGAAGCTGAGTCGGTGGGCAGGGTGGAGCTCGGCACAGGCACAGAGCCACCCTCCCAACGGCGCACCTGCCAGGCCACCGTGCCCCACGAGGACACGTTCTCGGCAGCTGACCTCACGCGCGTTGGAGAATCCACTGCACATCGGGAGGGTGCGGAATCGGCTGTGGCCACCGTGGAAGCGGTTCAGGGGAGGCCTGGGGGGACGTGGCCCTGCCCAGCCTCCTTCCATCCGGGACATGCAGCCCTTCTCCCCTGTGCCCAGGAAGACCTGGTTTCTGGGGCTCCTTTCAGCCCCAGGGGAGCCAACTTCCATTTTCAGCCAGTGCAGAAAGCCGGAGCCTCCAAGACTGGACTTTGCCAGGCAGAAGGAGACAGCAGGCCCCCCCAAGATGTCTGCCTGCCTGAGCCCAGCAAGCAGCCTGGCCCACAGCTGGATGCCGGGAGTTTAGCAAAGTGCAGCCCCGACCAGGAACTTTCATTTCCTAAGAATAAGGAGGCCGCCAGCTCACAAGAAAGTGAAGACTCCCTGCGGCTGCTTCCCTGTGAACAGAGAGGAGGGTTCCTCCCAGAGCCCGGCACAGCAGACCAGCCCCACCGAGGGGCCCCTGCTCCAGAAGCTTTTGGCAGCCCTGCTGTCCATCTGGCCCCTGACTTGGCATTTCAGGGTGACGGGGCTCCACCTCTGGATGCCACCTGGCCTTTTGGTGCCAGTCCCAGCCATGCTGCCCAGGGACATTCTGCAGGCAGAGCAGGTGGGCACCTCCACCCCACGGCAGGGAGGCCTGGCTTTGAGGGTAATGAGTTTGCACCGGCGGGGGCCTCCTCACTGACTGCCCCCCGGGGCAGGGAGGCTTGGTTGGTCCCTGTGCCAAGTCCCGCCTGTGTATCCAACACCCACCCTAGCAGGAGGTCCCAGGACCCAGCTTTGAGCCCCCCCATACGTCAGCTCCAGCTCCCAGGGCCTGGAGTGGCTAAGAGTAAAGATGGCATCCTGGGCTTGCAGGAGCTGACACCTGCTGCCCAGAGCCCTCCACGAGTGAACCCCTCAGGTCTGGAAGGGGGCACTGTGGAAGGAGGGAAGGTGGCCTGTGGCCCCGCCCAGGGCTCCCCAGGGGGTGTGCAGGTGACAACTCTCCCTGCAGTGGCCGGACATCAGCTGGGGCTGGAGGCAGATGGACATTGGGGCTTGCTTGGCCAAGCCGAGAAAACCCAGGGCCAAGGCACAGCCAACCAGCTTCAGCCAGAGAACGGGGTGAGCCCAGGGGGCACGGACAACCACGCCTCAGTCAATGCCAGTCCCAAAACAGCGCTGACCGGCCCCACCGAGGGTGCAGTCCTGCTAGAGAAATGCAAGGGAAGCAGGGCAGCCATGAGCCTTCAGGAGGAGGCCGAGCCCACCCCAAGCCCCCCGTCCCCTAATAGGGAGTCCCTGGCGCTGGCCTTGACAGCAGCCCACAGCCGAAGTGGATCTGAGGGCCGGACTCCAGAGAGGGCGTCCAGCCCCGGCCTGAACAAGCCACTGCTGGCCACAGGGGATAGCCCAGCACCCTCTGTCGGGGACCTGGCCGCCTGCGCCCCCTCACCCACTTCAGCCGCCCACATGCCCTGCAGCCTTGGGCCCCTGCCCCGTGAAGACCCACTTACCTCGCCTTCCAGGGCCCAAGGTGGGCTGGGGGGGCAGCTGCCAGCATCTCCGTCCTGCAGGGACCCTCCCGGCCCCCAGCAGCTGCTGGCCTGTTCTCCTGCCTGGGCACCTCTGGAAGAGGCAGATGGCGTCCAAGCCACGACAGATACTGGGGCTGAGGATTCCCCGGTGGCTCCCCCGTCTTTGACAACAAGCCCCTGCGATCCCAAGGAAGCCCTGGCTGGTTGCCTTCTCCAGGGGGAGGGCAGCCCCCTGGAAGACCCTTCCTCCTGGCCTCCTGGCTCCGTCAGTGCTGTAACCTGCACTCACAGTGGGGACACCCCCAAAGACAGCACTTTAAGAATTCCAGAGGATTCCAGAAAAGAGAAGCTGTGGGAGTCTCCTGGCCGAGCCACCTCTCCTCCTCTGGCAGGGGCCGTCTCCCCCAGCGTGGCCGTCAGGGCTACTGGCCTGTCCAGCACTCCCACCGGAGATGAGGCACAGGCAGGCAGGGGACTCCCAGGGCCAGACCCCCAGAGCAGGGGAGCCCCGCCCCACACCAACCCTGACAGGATGCCCAGGGGCCACTCCTCGTATTCTCCAAGCAATACTGCCCGCCTCGGCCACAGGGAGGGCCAGGCTGTCACAGCTGTGCCCACTGAGCCTCCCACGCTACAGGGTGCAGGGCCGGACTCCCCCGCCTGCCTGGAAGGTGAGATGGGGACCAGCAGCAAGGAGCCGGAGGACCCAGGGACCCCTGAGACCGGGCGCTCTGGTGCTACCAAGATGCCCAGGGTCACCTGCCCTTCCACAGGACTGGGCTTGGGAAGAACCACAGCCCCAAGCAGCACAGCCAGTGACTTCCAGTCTGACTCCCCCCAAAGCCACAGAAATGCCTCCCACCAGACTCCCCAGGGGGACCCCCTCGGCCCCCAAGACCTCAAACAGAGGTCCCGTGGCTATAAAAAGAAGCCTGCATCTACAGAGAACGGCCAGTGGAAGGGCCAAGCTCCACATGGGCCTGTGACCTGTGAGGTCTGCGCAGCCTCCTTCCGCTCCGGGCCGGGCCTGAGCCGGCACAAGGCCAGGAAGCACCGGCCACACCCGGGAGCCCCCGCGGAGCCGAGCCCAGCGGCCTTGCCTGCTCAGCAGCCTCTAGAGCCCCTAGCCCAAAAGTGCCAGCCGCCCAGGAAGAAAAGCCACAGGGTGTCTGGGAAGGAGAGACCAAATCACTCACGGGGAGACCCCAGCCACGTCACCCAGCCACCGCCTGCCCAGGGCTCAAAGGAGGTTCTCAGAGCACCGGGGTCCCCACACAGCCAGCAGCTGCACCCTCCAAGCCCTACTGAGCATGAGGTAGATGTGAAGACTCCGGCCTCCAAGCCCAGACCAGACCAGGCCAGGGAAGATGAGCTGCATCCCAAACAGGCAGAAAAAAGAGAAGGCCGGAGGTGGCGCCGAGAGCCCACCGTGGACTCTCCTAGCCACTCAGAGGGGAAGTCAAATAAGAAAAGGGGAAAGCTGAGAGGGAGAAGGCTCCGGGAGGAGAGCATTCTTCCAGTCTCTGCTGATGTGATTTCAGATGGGCGCGGCTCCAGACCATCCCCTGCAATGGCCAGTTACGCAGCCTCTCCGAGCCACTGCCTCTCTGTGGAAGGAGGGCCTGAGGCTGACGGGGAGCAGCCGCCTCGCTTGGCCACTCTGGGACCTGGGGTGATGGAGGGTGCAGCGGAGACTGACCAGGAGGCTCTGTGTGCAGGGGAGACTGGGGCCCAGAAGCCACCTGGAGATCGGATGCTGTGTCCAGGGAGGATGGATGGTGCAGCTCTGGGGGAACAGCCAACTGGGCAGAAGGGAGCCTCGGCAAGGGGGTTCTGGGGACCAAGAGAGACCAAGGCGTTGGGTGTGTGCAAAGAGTCTGGGAGCGAGCCTGCGGAGGACAGCAGCAGGGCCCACAGCCGATCAGAGGAAGGTGTCTGGGAGGAGAACACGCCCCCCTTGGGCCCCCTGGGTTTTCCCGAGACTTCCAGCTCTCCGGCGGACAGCACCACCAGCAGCTGCCTCCAGGGCCTCCCGGACAACCCAGACACCCAGGGTGGAGTCCAGGGGCCTGAAGGCCCCACTCCTGATGCCTCTGGCTCCAGTGCCAAGGATCCTCCAAGCTTGTTTGATGATGAGGTCTCTTTCTCCCAGCTCTTCCCTCCAGGCGGTCGCTTGACTAGAAAGAGGAACCCGCATGTCTACGGGAAGCGCTGTGAGAAGCCGGTGCTCCCGCTGCCAACCCAGCCCAGCTTTGAGGAGGGCGGTGACCCCACGCTGGGCCCAGCCCGCCTGCCCACGGACCTCAGCGACTCCAGCTCCCTCTGCCTCTGCCATGAGGACCCGTGGGAGGACGAGGATCCCGCAGGTCTGCCCGAGTCCTTCCTCCTGGATGGGTTCCTCAATAGCAGGGTGCCTGGCATTGACCCCTGGGCCCCCGGCCTCAGCCTGTGGGCCCTGGAGCCCAGCAGGGAAGCTGGTGCAGAGAAGCTGCCCTCCCACTGCCCCGAGGACGATCGGCCGGAGGCCATTCCTGAGCTGCACATGGTCCCAGCGGCTTGGCGAGGCCTGGAGATGCCGGCCCCTGCCGATGACTCCTCCTCTTCTCTCGGAGATGTGAGCCCCGAGCCCCCCAGCCTGGAGAGAGAACGCTGTGACGGTGGGCTTCCCGGGAACACCCACCTGCTGCCGCTCCGTGCCACGGACTTTGAGGTGCTCAGCACCAAGTTTGAGATGCAAGACCTGTGCTTTCTGGGACCCTTTGAAGACCCCGTGGGTCTCCCCGGCCCCAGCTTCTTAGACTTCGAGGGCACGGCGAGCTCACAGGGGCCACAGAGCCGAAGGACAGAGGAGGCTGCAGGGGCAGGGAGGGCCCAAGGCAGAGGCCGGCCGGCCAAGGGCAGGCGGGCCTCCTACAAGTGCAAAGTGTGCTTCCAGCGCTTCCGCAGCCTGGGCGAGCTGGACCTGCACAAGCTGGCCCACACGCCCGCGCCGCCGCCCACCTGCTACATGTGCGTGGAGCGCAGGTTTGGCTCGCGGGAGCTGCTGCGGGGGCACCTGCAGGAGAGGCACGCGCAGAGCAAGGCCGGGCCCTGGGCGTGCGGCATGTGCCTGAAGGAGGTGGCCGACGTCTGGATGTACAACGAGCACCTGCGTGAGCACGCGGTCCGCTTCGCCCGCAGGGGGCAGGCGCGGAGGTCCTTGGGGGACCTGCCCGGAGGCCTGGAGGGCAGCAGCGCTGTCGCCCACCTTCTGAACAGCATCACGGAACCCGCGCCCAAACACCACAGGGGCAAGCGCTCCGCCGGCAAGGCCGCCGGGAGCCCGGGAGACCCGTGGGGGCAAGAGGGAGAAGCCAAGAAAGACAGCCCGGGCGAGAGGGCGAAACCCCGGGCACGCAGCACCCCCAGCAACCCAGACGGGGCCGCGACCCCAGACAGCGCCTCTGCCACCGCCCTGGCTGACGCCGGCAGCCCGGGCCCCCCCAGGACGACCCCCAGCCCGTCCCCCGACCCCTGGGCCGGCGGGGAGCCCCTCCTGCAAGCCACCCCGGTGCACGAGGCCTGCAAGGACCCCTCCCGCGACTGCCACCACTGCGGGAAGCGCTTCCCCAAGCCCTTCAAGCTGCAGCGCCACCTGGCGGTGCACAGCCCGCAGCGCGTCTACCTGTGCCCCCGGTGCCCCCGGGTCTACCCCGAGCACGGGGAGCTGCTGGCACACCTGGGCGGGGCGCACGGGCTGCTGGAGCGGCCGGAGCTGCAGCACACGCCGCTGTATGCCTGCGAGCTCTGCGCCACGGTTATGCGCATCATCAAGAAGTCCTTCGCCTGCAGCTCCTGCAACTACACCTTCGCCAAGAAGGAGCAGTTCGACCGCCACATGAACAAGCACCTCAGGGGGGGGCGGCAGCCCTTCGCGTTCCGCGGCGTGCGGAGGCCGGGAGCGCCGGGACAGAAGGCCCGGGCCCTCGAGGGCACACTGCCCAGCAAACGGCGCAGGGTGGCCATGCCCGGCAGTGCCCCTGGGCCCGGCGAGGACAGGCCTCCTCCCCGGGGAAGCAGCCCCATCCTGAGTGAGGGCTCTCTCCCGGCCCTGCTCCACCTGTGTTCGGAGGTGGCTCCCAGCACCACCAAGGGATGGCCCGAGACCCTAGAGAGGCCTGTAGACCCCGTGACCCACCCGATCAGAGGTTGTGAGCTGCCATCCAACCACCAGGAGTGTCCCCCGCCGTCTCTGTCTCCCTTCCCAGCTGCCTTGGCTGATGGCAGAGGAGACTGCGCGCTGGACGGAGCCCTGGAGAGGCCAGAGAACGAGGCTTCCCCAGGCAGCCCCGGGCCTCTTCTCCAGCAAGCTCTCCCTCTGGGGGCATCTCTGCCGCGGCCGGGAGCCAGAGGCCAAGATGCGGAGGGAAAGAGGGCTCCTCTCGTGTTCTCAGGGAAACGCAGGGCCCCGGGTGCCCGTGGCAGGTGTGCCCCTGACCATTTCCAGGAAGACCACCTACTTCAGAAAGAGAAGGAGGTGTCCTCAAGCCACATGGTGTCTGAGGGGGGGCCCCGAGGCGCCTTCCACAAGGGCAGCGCCACCAAGCCTGCGGGCTGCCAGAGCTCATCAAAGGACAGGTCGGCAGCATCCACCCCCAGCAAAGCACTCAAGTTCCCAGTGCACCCAAGGAAGGCGGTGGGGAGCCTGGCACCCGGGGAGCTGGCCCGTGGCACAGAGAATGGGATGAAGCCCGCCACCCCCAAAGCCAAACCCGGCCCCAGCTCCCAGGGCAGTGGAAGCCCTCGCCCCGGCACCAAGACAGGAGGTGGCAGCCAGCCCCAGCCAGCCAGCGGGCAGCTCCAGAGCGAGACAGCCACCACCCCAGCCAAGCCCAGCTTCCCCAGCCGGAGCCCTGCACCAGAGAGGCTCCCCGCTCGAGCCCAAGCCAAGAGCTGCACCAAGGGGCCAAGGGAAGCTGGTGAGCAGGGGCCCCACGGGAGCCTAGGTCCCAAGGAGAAGGGAGAGAGCAGTACGAAGAGGAAAAAGGGCCAGGTCCCAGGGCCAGCCAGGAGTGAAAGTGTGGGGAGCTTCGGGAGAGCCCCCTCAGCCCCTGACAAGCCCCCCCGGACCCCTCGGAAGCAGGCAACTCCCAGCCGCGTGCTCCCGACCAAGCCCAAGCCCAACAGCCAGAACAAACCCAGGCCGCCACCATCAGAGCAGCGGAAGGCAGAGCCGGGCCACACACAGAGGAAGGACAGACTGGGCAAGGCCTTCCCCCAGGGGAGACCCCTGCTCAGGCCCCCCAAGAGGGGCACAGCTGTCCACGGTGCTGAACCTGCCGAGCCACACACCCACCGGACGGCCGAGGCCCAGAGTGACCTCCTCAGCCAGCTCTTCGGGCAGAGACTAACTGGCTTCAAAATCCCTTTAAAGAAAGATGCTTCCGAGTAA

Back to List