Details for gene: PRDM5


protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; transcription cis-regulatory region binding : Interacting selectively and non-covalently with a specific sequence of DNA that is part of a regulatory region that controls transcription of that section of the DNA. The transcribed region might be described as a gene, cistron, or operon. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; transferase activity : Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2. ; nucleoplasm : That part of the nuclear content other than the chromosomes or the nucleolus. ; nucleolus : A small, dense body one or more of which are present in the nucleus of eukaryotic cells. It is rich in RNA and protein, is not bounded by a limiting membrane, and is not seen during mitosis. Its prime function is the transcription of the nucleolar DNA into 45S ribosomal-precursor RNA, the processing of this RNA into 5.8S, 18S, and 28S components of ribosomal RNA, and the association of these components with 5S RNA and proteins synthesized outside the nucleolus. This association results in the formation of ribonucleoprotein precursors; these pass into the cytoplasm and mature into the 40S and 60S subunits of the ribosome. ; methyltransferase activity : Catalysis of the transfer of a methyl group to an acceptor molecule. ; methylation : The process in which a methyl group is covalently attached to a molecule. ; DNA binding : Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid). ; negative regulation of transcription, DNA-templated : Any process that stops, prevents, or reduces the frequency, rate or extent of cellular DNA-templated transcription. ; chromatin organization : Any process that results in the specification, formation or maintenance of the physical structure of eukaryotic chromatin. ; nuclear body : Extra-nucleolar nuclear domains usually visualized by confocal microscopy and fluorescent antibodies to specific proteins. ; sequence-specific DNA binding : Interacting selectively and non-covalently with DNA of a specific nucleotide composition, e.g. GC-rich DNA binding, or with a specific sequence motif or type of DNA e.g. promotor binding or rDNA binding. ; RNA polymerase II transcription regulatory region sequence-specific DNA binding : Interacting selectively and non-covalently with a specific sequence of DNA that is part of a regulatory region that controls the transcription of a gene or cistron by RNA polymerase II. ; DNA-binding transcription factor activity : A transcription regulator activity that modulates transcription of gene sets via selective and non-covalent binding to a specific double-stranded genomic DNA sequence (sometimes referred to as a motif) within a cis-regulatory region. Regulatory regions include promoters (proximal and distal) and enhancers. Genes are transcriptional units, and include bacterial operons. ; regulation of gene expression : Any process that modulates the frequency, rate or extent of gene expression. Gene expression is the process in which a gene's coding sequence is converted into a mature gene product or products (proteins or RNA). This includes the production of an RNA transcript as well as any processing to produce a mature RNA product or an mRNA or circRNA (for protein-coding genes) and the translation of that mRNA or circRNA into protein. Protein maturation is included when required to form an active form of a product from an inactive precursor form. ; DNA-binding transcription factor binding : Interacting selectively and non-covalently with a DNA-binding transcription factor, a protein that interacts with a specific DNA sequence (sometimes referred to as a motif) within the regulatory region of a gene to modulate transcription. ; RNA polymerase II cis-regulatory region sequence-specific DNA binding : Interacting selectively and non-covalently with a specific upstream regulatory DNA sequence (transcription factor recognition sequence or binding site) located in cis relative to the transcription start site (i.e., on the same strand of DNA) of a gene transcribed by RNA polymerase II. ; DNA-binding transcription repressor activity, RNA polymerase II-specific : A DNA-binding transcription factor activity that represses or decreases the transcription of specific gene sets transcribed by RNA polymerase II. ; negative regulation of transcription by RNA polymerase II : Any process that stops, prevents, or reduces the frequency, rate or extent of transcription mediated by RNA polymerase II. ; mitotic cell cycle : Progression through the phases of the mitotic cell cycle, the most common eukaryotic cell cycle, which canonically comprises four successive phases called G1, S, G2, and M and includes replication of the genome and the subsequent segregation of chromosomes into daughter cells. In some variant cell cycles nuclear replication or nuclear division may not be followed by cell division, or G1 and G2 phases may be absent. ; histone deacetylation : The modification of histones by removal of acetyl groups. ; histone H3-K9 methylation : The modification of histone H3 by addition of one or more methyl groups to lysine at position 9 of the histone. ; cellular response to leukemia inhibitory factor : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a leukemia inhibitory factor stimulus. ;


Symbol
PRDM5
Name
PR/SET domain 5
Entrez ID
11107
Ensembl ID
ENSG00000138738    (more details)
KEGG ID
hsa:11107    (more details)
OMIM ID
614161
Uniprot ID
Q9NQX1  
GO ID
hsa:11107    (more details)
Chromosome
9
Strand
-1
Start
132261356
End
132354986
miRNA Interactions
hsa-miR-212-3p (RPM: 7.7608) / hsa-miR-1304-5p (RPM: 0.1148) / hsa-miR-19b-3p (RPM: 197.0578) / hsa-miR-19a-3p (RPM: 25.4064) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-let-7f-5p (RPM: 17066.6836) / hsa-let-7c-5p (RPM: 4028.6728) / hsa-let-7i-5p (RPM: 2025.2084) / hsa-miR-98-5p (RPM: 1660.0964) / hsa-let-7e-5p (RPM: 3790.2074) / hsa-let-7g-5p (RPM: 3559.4376) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-let-7d-5p (RPM: 1078.3154) / hsa-miR-122-5p (RPM: 0.5028) / hsa-miR-196b-5p (RPM: 0.2478) /
Involved Diseases
Keratoconus /
Involved Pathways
Sequence
ATGCTGGGCATGTACGTGCCGGACAGGTTCTCCCTGAAGTCCTCCCGGGTTCAGGACGGCATGGGGCTCTACACGGCCCGCAGAGTGCGAAAGGGTGAAAAGTTCGGACCCTTTGCTGGAGAGAAGAGAATGCCTGAAGACTTGGATGAAAATATGGATTACAGGTTGATGTGGGAGGTTCGTGGGAGTAAGGGAGAAGTTTTGTACATTTTGGATGCTACCAACCCACGGCACTCCAACTGGCTTCGCTTCGTTCATGAGGCACCATCTCAGGAGCAGAAGAACTTGGCTGCCATTCAAGAAGGAGAAAACATTTTCTATTTGGCAGTTGAAGATATAGAAACAGACACGGAGCTTCTGATTGGCTACCTGGATAGTGACATGGAGGCTGAGGAGGAAGAACAGCAAATTATGACAGTCATCAAAGAAGGGGAAGTTGAAAATTCTAGAAGACAATCAACAGCGGGCAGAAAAGATCGCCTTGGCTGTAAAGAGGACTATGCTTGTCCTCAATGTGAATCGAGTTTTACCAGTGAGGATATTCTTGCTGAGCATCTCCAGACATTGCACCAGAAACCCACAGAGGAGAAAGAATTTAAGTGCAAGAACTGTGGGAAGAAATTCCCAGTTAAGCAGGCTTTGCAAAGACATGTTCTTCAGTGCACAGCGAAAAGCAGTCTAAAGGAGTCTTCGCGAAGTTTTCAGTGCTCTGTTTGCAATTCTTCCTTCAGTTCAGCATCGAGTTTTGAGCAGCACCAGGAGACTTGCCGGGGGGATGCCAGGTTTGTGTGCAAGGCTGACAGCTGTGGAAAGAGGCTGAAGAGCAAGGATGCCCTGAAAAGACACCAGGAAAATGTCCACACTGGAGATCCTAAGAAAAAGCTTATATGTTCAGTGTGCAATAAAAAGTGTTCTTCAGCATCAAGCCTACAGGAACATAGAAAGATTCATGAGATATTTGATTGTCAAGAATGTATGAAGAAATTTATTTCAGCTAATCAGCTAAAACGTCATATGATCACCCACTCAGAAAAACGACCCTATAATTGCGAGATTTGTAATAAGTCTTTCAAGAGGCTTGATCAAGTGGGTGCTCACAAAGTAATACACAGCGAAGACAAACCTTACAAATGCAAACTTTGTGGAAAGGGATTTGCCCACAGAAATGTTTACAAGAATCATAAGAAGACCCACTCTGAGGAGAGACCGTTCCAATGTGAAGAATGTAAAGCTTTGTTCCGGACCCCATTTTCTTTACAGAGACACCTGCTAATACATAACAGTGAGAGGACTTTCAAGTGCCATCACTGCGATGCTACCTTTAAGAGGAAGGATACATTAAATGTTCATGTCCAGGTGGTTCATGAAAGACACAAGAAGTATAGGTGTGAGCTATGTAATAAGGCCTTTGTTACACCTTCAGTGCTTAGAAGTCATAAGAAAACACATACAGGAGAAAAGGAGAAAATCTGTCCATATTGTGGCCAGAAATTTGCCAGCAGTGGTACACTCAGAGTTCATATCCGGAGCCACACAGGTGAGCGTCCCTATCAATGTCCTTACTGTGAAAAAGGATTCAGTAAAAATGATGGACTGAAGATGCACATTCGTACTCACACCAGGGAGAAGCCGTACAAGTGCTCAGAGTGCAGCAAGGCCTTCAGCCAGAAGCGAGGCCTGGATGAGCACAAGAGGACGCACACTGGAGAAAAGCCTTTTCAGTGTGATGTTTGTGATTTGGCTTTTAGCCTGAAGAAAATGCTGATTCGACACAAGATGACTCATAATCCCAATCGTCCCCTGGCAGAATGCCAGTTTTGCCATAAGAAGTTTACAAGGAATGACTACCTCAAAGTGCACATGGACAATATCCATGGTGTAGCTGACAGCTAA

Back to List