Details for gene: SETX


helicase activity : Catalysis of the reaction: ATP + H2O = ADP + phosphate, to drive the unwinding of a DNA or RNA helix. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; nucleotide binding : Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose. ; ATP binding : Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator. ; negative regulation of apoptotic process : Any process that stops, prevents, or reduces the frequency, rate or extent of cell death by apoptotic process. ; nucleoplasm : That part of the nuclear content other than the chromosomes or the nucleolus. ; hydrolase activity : Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3. ; DNA binding : Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid). ; intercellular bridge : A direct connection between the cytoplasm of two cells that is formed following the completion of cleavage furrow ingression during cell division. They are usually present only briefly prior to completion of cytokinesis. However, in some cases, such as the bridges between germ cells during their development, they become stabilised. ; chromosome : A structure composed of a very long molecule of DNA and associated proteins (e.g. histones) that carries hereditary information. ; nuclear body : Extra-nucleolar nuclear domains usually visualized by confocal microscopy and fluorescent antibodies to specific proteins. ; cell differentiation : The process in which relatively unspecialized cells, e.g. embryonic or regenerative cells, acquire specialized structural and/or functional features that characterize the cells, tissues, or organs of the mature organism or some other relatively stable phase of the organism's life history. Differentiation includes the processes involved in commitment of a cell to a specific fate and its subsequent development to the mature state. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; nucleolus : A small, dense body one or more of which are present in the nucleus of eukaryotic cells. It is rich in RNA and protein, is not bounded by a limiting membrane, and is not seen during mitosis. Its prime function is the transcription of the nucleolar DNA into 45S ribosomal-precursor RNA, the processing of this RNA into 5.8S, 18S, and 28S components of ribosomal RNA, and the association of these components with 5S RNA and proteins synthesized outside the nucleolus. This association results in the formation of ribonucleoprotein precursors; these pass into the cytoplasm and mature into the 40S and 60S subunits of the ribosome. ; DNA repair : The process of restoring DNA after damage. Genomes are subject to damage by chemical and physical agents in the environment (e.g. UV and ionizing radiations, chemical mutagens, fungal and bacterial toxins, etc.) and by free radicals or alkylating agents endogenously generated in metabolism. DNA is also damaged because of errors during its replication. A variety of different DNA repair pathways have been reported that include direct reversal, base excision repair, nucleotide excision repair, photoreactivation, bypass, double-strand break repair pathway, and mismatch repair pathway. ; cellular response to DNA damage stimulus : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating damage to its DNA from environmental insults or errors during metabolism. ; positive regulation of transcription by RNA polymerase II : Any process that activates or increases the frequency, rate or extent of transcription from an RNA polymerase II promoter. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; DNA recombination : Any process in which a new genotype is formed by reassortment of genes resulting in gene combinations different from those that were present in the parents. In eukaryotes genetic recombination can occur by chromosome assortment, intrachromosomal recombination, or nonreciprocal interchromosomal recombination. Interchromosomal recombination occurs by crossing over. In bacteria it may occur by genetic transformation, conjugation, transduction, or F-duction. ; DNA duplex unwinding : The process in which interchain hydrogen bonds between two strands of DNA are broken or 'melted', generating a region of unpaired single strands. ; nervous system development : The process whose specific outcome is the progression of nervous tissue over time, from its formation to its mature state. ; rhythmic process : Any process pertinent to the generation and maintenance of rhythms in the physiology of an organism. ; RNA processing : Any process involved in the conversion of one or more primary RNA transcripts into one or more mature RNA molecules. ; double-strand break repair : The repair of double-strand breaks in DNA via homologous and nonhomologous mechanisms to reform a continuous DNA helix. ; axon : The long process of a neuron that conducts nerve impulses, usually away from the cell body to the terminals and varicosities, which are sites of storage and release of neurotransmitter. ; chromosome, telomeric region : The end of a linear chromosome, required for the integrity and maintenance of the end. A chromosome telomere usually includes a region of telomerase-encoded repeats the length of which rarely exceeds 20 bp each and that permits the formation of a telomeric loop (T-loop). The telomeric repeat region is usually preceded by a sub-telomeric region that is gene-poor but rich in repetitive elements. Some telomeres only consist of the latter part (for eg. D. melanogaster telomeres). ; DNA helicase activity : Catalysis of the reaction: ATP + H2O = ADP + phosphate; this reaction drives the unwinding of the DNA helix. ; MAPK cascade : An intracellular protein kinase cascade containing at least a MAPK, a MAPKK and a MAP3K. The cascade can also contain an additional tiers: the upstream MAP4K. The kinases in each tier phosphorylate and activate the kinase in the downstream tier to transmit a signal within a cell. ; spermatogenesis : The developmental process by which male germ line stem cells self renew or give rise to successive cell types resulting in the development of a spermatozoa. ; identical protein binding : Interacting selectively and non-covalently with an identical protein or proteins. ; nuclear chromosome : A chromosome that encodes the nuclear genome and is found in the nucleus of a eukaryotic cell during the cell cycle phases when the nucleus is intact. ; growth cone : The migrating motile tip of a growing neuron projection, where actin accumulates, and the actin cytoskeleton is the most dynamic. ; RNA binding : Interacting selectively and non-covalently with an RNA molecule or a portion thereof. ; termination of RNA polymerase II transcription : The process in which the synthesis of an RNA molecule by RNA polymerase II using a DNA template is completed. ; cellular response to retinoic acid : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a retinoic acid stimulus. ; cellular response to oxidative stress : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of oxidative stress, a state often resulting from exposure to high levels of reactive oxygen species, e.g. superoxide anions, hydrogen peroxide (H2O2), and hydroxyl radicals. ; cellular response to fibroblast growth factor stimulus : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an fibroblast growth factor stimulus. ; DNA-templated transcription, termination : The cellular process that completes DNA-templated transcription; the formation of phosphodiester bonds ceases, the RNA-DNA hybrid dissociates, and RNA polymerase releases the DNA. ; cellular response to hydrogen peroxide : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a hydrogen peroxide (H2O2) stimulus. ; fibroblast growth factor receptor signaling pathway : The series of molecular signals generated as a consequence of a fibroblast growth factor receptor binding to one of its physiological ligands. ; positive regulation of neuron projection development : Any process that increases the rate, frequency or extent of neuron projection development. Neuron projection development is the process whose specific outcome is the progression of a neuron projection over time, from its formation to the mature structure. A neuron projection is any process extending from a neural cell, such as axons or dendrites (collectively called neurites). ; mRNA splice site selection : Selection of a splice site by components of the assembling spliceosome. ; positive regulation of RNA splicing : Any process that activates or increases the frequency, rate or extent of RNA splicing. ; protein kinase B signaling : A series of reactions, mediated by the intracellular serine/threonine kinase protein kinase B (also called AKT), which occurs as a result of a single trigger reaction or compound. ; transcription termination site sequence-specific DNA binding : Interacting selectively and non-covalently with a sequence of DNA that promotes termination by RNA polymerase. The transcribed region might be described as a gene, cistron, or operon. ; circadian rhythm : Any biological process in an organism that recurs with a regularity of approximately 24 hours. ; positive regulation of DNA-templated transcription, termination : Any process that increases the rate, frequency or extent of DNA-templated transcription termination, the process in which transcription is completed; the formation of phosphodiester bonds ceases, the RNA-DNA hybrid dissociates, and RNA polymerase releases the DNA. ; positive regulation of DNA-templated transcription, initiation : Any process that activates or increases the frequency, rate or extent of DNA-templated transcription initiation. ; positive regulation of termination of RNA polymerase II transcription, poly(A)-coupled : Any process that activates or increases the frequency, rate or extent of termination of RNA polymerase II transcription, poly(A)-coupled. ;


Symbol
SETX
Name
senataxin
Entrez ID
23064
Ensembl ID
ENSG00000107290    (more details)
KEGG ID
hsa:23064    (more details)
OMIM ID
602433
Uniprot ID
Q7Z333  
GO ID
hsa:23064    (more details)
Chromosome
6
Strand
-1
Start
152121687
End
152637801
miRNA Interactions
hsa-miR-15a-5p (RPM: 139.425) / hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-141-3p (RPM: 2843.5066) / hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-15b-5p (RPM: 133.5752) / hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-106b-5p (RPM: 35.4204) / hsa-miR-126-5p (RPM: 3089.0568) / hsa-miR-200a-3p (RPM: 157.5826) / hsa-miR-27b-3p (RPM: 22876.2392) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-101-3p (RPM: 3335.0564) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-922 (RPM: 0.0014) / hsa-miR-106a-5p (RPM: 7.9736) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-377-3p (RPM: 4.0398) / hsa-miR-4326 (RPM: 2.7166) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-92a-3p (RPM: 16961.15) / hsa-miR-590-3p (RPM: 4.5954) / hsa-miR-513a-5p (RPM: 0.3656) / hsa-miR-503-5p (RPM: 0.0972) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-148a-3p (RPM: 10339.6222) / hsa-miR-4705 (RPM: 0.444) / hsa-miR-1301-3p (RPM: 47.2112) / hsa-miR-148b-3p (RPM: 970.7614) / hsa-miR-369-3p (RPM: 7.3414) / hsa-miR-2467-5p (RPM: 3.8758) / hsa-miR-361-5p (RPM: 182.4758) / hsa-miR-9-5p (RPM: 3525.806) / hsa-miR-30e-3p (RPM: 538.304) / hsa-miR-30a-3p (RPM: 889.1386) / hsa-miR-484 (RPM: 434.5276) / hsa-miR-30d-3p (RPM: 57.136) / hsa-let-7f-1-3p (RPM: 9.5776) / hsa-miR-539-5p (RPM: 2.3354) / hsa-let-7b-3p (RPM: 92.0818) / hsa-miR-610 (RPM: 0.032) / hsa-let-7a-3p (RPM: 33.7298) / hsa-miR-876-5p (RPM: 0.4744) / hsa-miR-432-5p (RPM: 29.044) / hsa-miR-19b-1-5p (RPM: 0.1482) / hsa-miR-374b-5p (RPM: 72.7188) / hsa-miR-214-3p (RPM: 21.2784) / hsa-miR-545-5p (RPM: 0.3484) / hsa-miR-21-5p (RPM: 5494.851) / hsa-miR-127-3p (RPM: 3339.395) / hsa-miR-181a-5p (RPM: 52364.6344) / hsa-miR-412-3p (RPM: 0.02) / hsa-miR-502-5p (RPM: 0.9904) / hsa-miR-181b-3p (RPM: 2.493) / hsa-miR-4802-3p (RPM: 0.0722) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-136-3p (RPM: 178.2682) / hsa-miR-1229-3p (RPM: 1.3764) / hsa-miR-764 (RPM: 0.0112) / hsa-miR-142-3p (RPM: 8.3404) / hsa-miR-338-5p (RPM: 16.892) / hsa-miR-671-5p (RPM: 10.1036) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-18a-3p (RPM: 5.394) / hsa-miR-485-3p (RPM: 10.0736) / hsa-miR-19a-5p (RPM: 0.3142) / hsa-miR-3200-5p (RPM: 1.6936) / hsa-miR-1283 (RPM: 0.0564) / hsa-miR-25-3p (RPM: 1063.0626) / hsa-miR-148b-5p (RPM: 20.6792) / hsa-miR-541-5p (RPM: 0.146) / hsa-miR-3934-5p (RPM: 0.4022) / hsa-miR-873-3p (RPM: 8.911) / hsa-miR-382-5p (RPM: 9.8234) / hsa-miR-586 (RPM: 0.0128) / hsa-miR-651-5p (RPM: 2.417) / hsa-miR-513c-5p (RPM: 0.9144) / hsa-miR-330-3p (RPM: 21.3424) / hsa-miR-4477b (RPM: 0.0392) / hsa-miR-93-3p (RPM: 9.5402) / hsa-miR-29a-5p (RPM: 3.125) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-501-5p (RPM: 3.2752) / hsa-miR-125a-3p (RPM: 24.5112) / hsa-miR-362-5p (RPM: 9.5016) / hsa-miR-500b-5p (RPM: 0.928800000000001) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-218-5p (RPM: 36.775) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-2681-5p (RPM: 0.1438) / hsa-miR-191-5p (RPM: 12993.8088) / hsa-miR-324-5p (RPM: 32.337) / hsa-miR-3934-3p (RPM: 0.0126) /
Involved Diseases
Posterior capsule opacification (PCO) /
Involved Pathways
Sequence
ATGAGCACATGTTGTTGGTGTACGCCAGGTGGTGCTTCCACCATTGACTTCCTAAAGCGCTATGCTTCCAACACTCCGTCCGGTGAATTTCAAACAGCCGACGAAGACCTCTGCTACTGCTTGGAGTGTGTGGCTGAGTACCACAAAGCAAGAGATGAATTGCCATTCTTGCATGAGGTTTTATGGGAATTAGAAACCTTACGTCTCATAAATCACTTTGAAAAATCCATGAAGGCAGAAATTGGAGATGATGATGAGTTATATATAGTAGACAATAATGGAGAGATGCCACTGTTTGACATCACTGGGCAAGACTTTGAAAATAAGCTTCGAGTTCCTCTTCTTGAAATACTGAAATATCCTTACTTGCTTCTACATGAACGTGTTAACGAGTTATGTGTTGAAGCACTTTGTCGGATGGAACAAGCCAATTGCTCCTTTCAGGTGTTTGATAAACATCCAGGGATCTATTTGTTTTTAGTCCATCCCAATGAAATGGTTCGGCGTTGGGCTATCTTGACTGCAAGAAACTTGGGGAAAGTGGACAGAGATGATTATTATGACTTACAAGAAGTTTTACTTTGCCTTTTTAAAGTCATTGAGTTGGGGCTTTTAGAGAGTCCAGACATTTATACTTCTTCTGTCCTAGAGAAGGGTAAACTGATTCTTCTGCCCTCACACATGTATGATACTACCAACTACAAAAGCTATTGGTTAGGTATTTGCATGTTGCTGACCATTCTTGAGGAACAAGCCATGGATTCCCTGTTGTTGGGCTCAGACAAACAAAATGATTTTATGCAATCGATACTTCACACTATGGAGAGGGAAGCAGATGATGATAGTGTGGATCCTTTCTGGCCAGCGTTACACTGTTTTATGGTGATTCTGGATCGCCTTGGATCTAAGGTCTGGGGTCAACTTATGGATCCTATTGTGGCATTTCAAACCATTATCAACAACGCAAGCTACAATAGAGAGATCCGACATATACGGAACAGCTCTGTAAGGACCAAGTTAGAACCGGAGTCCTATTTGGATGATATGGTGACTTGCAGCCAGATCGTATACAATTATAATCCTGAAAAGACCAAAAAGGATTCTGGATGGAGAACAGCCATTTGCCCAGATTATTGTCCTAACATGTATGAAGAAATGGAAACATTAGCCAGTGTACTTCAGTCAGATATTGGTCAAGACATGCGTGTTCATAACAGCACATTTCTATGGTTCATCCCTTTTGTCCAGTCCCTCATGGATCTTAAGGATTTGGGTGTGGCTTACATAGCACAGGTTGTTAATCATCTGTACTCTGAAGTCAAAGAAGTCCTCAACCAAACAGATGCTGTGTGTGACAAAGTCACTGAATTTTTTCTTCTAATTTTGGTATCAGTGATTGAACTGCATAGAAATAAAAAATGTTTGCATTTGCTGTGGGTAAGTTCCCAGCAATGGGTGGAAGCCGTCGTCAAATGTGCCAAGCTTCCTACCACTGCGTTTACACGGAGTTCTGAGAAATCATCTGGAAATTGCTCCAAAGGAACAGCAATGATATCTTCACTGTCATTGCATTCCATGCCATCTAACTCTGTACAACTTGCTTATGTGCAGCTGATTAGAAGTCTCCTTAAAGAAGGTTATCAGCTTGGGCAGCAGTCTCTTTGCAAGCGATTCTGGGATAAGCTCAACTTATTCCTTAGAGGAAATTTATCTCTAGGTTGGCAGTTGACTAGTCAGGAAACCCATGAGCTACAAAGTTGCTTAAAGCAAATTATTAGAAACATAAAATTCAAAGCACCTCCATGTAACACTTTTGTGGATCTGACTTCTGCATGTAAAATCTCTCCTGCATCTTATAATAAAGAAGAAAGTGAACAAATGGGGAAGACGTCTAGAAAAGATATGCATTGTTTGGAAGCTTCCAGCCCAACATTTTCTAAAGAACCAATGAAAGTGCAAGACAGTGTATTGATCAAAGCAGATAACACTATAGAAGGTGACAATAATGAGCAAAATTATATAAAGGATGTGAAACTAGAGGACCATCTCTTAGCTGGGTCATGCTTAAAGCAGAGTAGTAAAAACATTTTTACTGAAAGAGCTGAAGATCAAATTAAAATAAGTACAAGGAAGCAGAAGTCTGTAAAAGAGATCTCTTCATATACACCAAAGGACTGTACTTCAAGAAATGGTCCAGAAAGGGGATGTGACAGAGGAATAATAGTATCAACACGTTTGTTGACTGATTCTAGCACTGATGCTTTGGAAAAAGTGTCCACATCGAATGAAGATTTCTCTTTAAAGGATGATGCTCTTGCTAAAACCTCAAAACGAAAAACTAAGGTACAGAAAGATGAAATCTGTGCAAAGTTATCACATGTAATAAAGAAGCAACACAGGAAGAGTACTTTGGTCGATAATACTATCAATTTAGATGAAAATTTGACTGTATCTAACATTGAGAGTTTCTATTCAAGGAAAGATACAGGAGTTCAGAAAGGAGATGGTTTCATACACAATCTTTCTTTAGACCCTAGTGGTGTTCTGGATGATAAGAATGGAGAACAAAAATCTCAAAACAATGTATTGCCAAAAGAGAAACAATTAAAGAATGAAGAATTAGTTATTTTCTCTTTCCATGAAAACAATTGTAAAATACAGGAATTTCATGTTGATGGTAAAGAATTGATCCCTTTTACAGAAATGACCAATGCTTCAGAGAAGAAATCATCTCCCTTTAAAGATCTTATGACTGTACCTGAATCAAGAGATGAGGAGATGAGTAATAGTACCAGTGTGATTTATTCTAACTTGACAAGAGAACAGGCCCCTGACATCAGTCCTAAATCTGACACCTTAACGGATTCTCAGATAGACAGAGACCTTCACAAATTATCTTTACTAGCTCAAGCCAGTGTTATTACGTTCCCATCCGATTCACCTCAGAACTCATCGCAGCTGCAAAGGAAAGTAAAAGAAGATAAAAGATGTTTCACAGCTAACCAAAATAATGTTGGAGATACCTCCCGTGGACAGGTTATTATTATTTCAGATTCTGATGATGATGATGATGAAAGAATCCTGAGTCTTGAGAAACTCACTAAACAGGACAAAATATGCCTTGAGAGGGAACATCCAGAGCAGCACGTTTCAACAGTTAATAGTAAGGAGGAAAAGAATCCAGTAAAGGAAGAAAAGACAGAGACTCTTTTTCAGTTTGAGGAATCTGATTCTCAGTGTTTTGAGTTTGAAAGTTCATCTGAAGTGTTTTCAGTTTGGCAAGATCATCCAGACGATAATAATTCAGTTCAAGATGGTGAGAAAAAATGTTTGGCTCCTATAGCCAATACTACAAATGGTCAGGGTTGTACAGATTATGTATCTGAAGTTGTTAAAAAAGGAGCAGAGGGCATTGAAGAACACACAAGACCACGGAGTATTTCTGTTGAAGAATTTTGTGAAATTGAAGTAAAAAAGCCTAAGAGAAAACGATCTGAAAAACCAATGGCTGAAGATCCTGTGAGGCCTTCATCTTCTGTCAGAAATGAGGGCCAGTCTGATACTAATAAGAGAGATCTTGTGGGAAATGATTTTAAAAGTATTGATAGAAGGACTTCAACTCCCAATTCACGTATTCAGAGAGCCACTACGGTTTCACAAAAGAAGTCTTCAAAGCTTTGTACTTGTACAGAACCCATCAGGAAAGTTCCAGTTTCTAAGACCCCTAAGAAAACTCATTCAGATGCCAAAAAAGGACAGAATAGAAGTTCAAATTACCTAAGTTGTAGAACAACTCCTGCTATAGTGCCGCCAAAGAAATTTCGTCAGTGTCCTGAGCCAACTTCAACAGCTGAGAAACTTGGCCTGAAAAAGGGTCCTCGTAAGGCATATGAGTTGTCCCAGCGGTCTTTGGATTATGTAGCTCAATTACGTGATCATGGCAAAACTGTTGGAGTAGTTGATACCCGAAAAAAGACTAAATTAATTTCTCCTCAGAACCTGTCTGTCAGAAATAATAAGAAACTTCTGACTAGTCAAGAACTTCAGATGCAAAGGCAGATCAGACCCAAATCACAAAAAAATAGACGAAGACTTTCTGATTGTGAAAGTACAGATGTTAAAAGAGCAGGGTCACATACAGCACAGAATTCTGACATATTTGTACCAGAATCTGATAGGTCAGATTATAATTGTACAGGAGGAACTGAGGTACTTGCCAACAGTAACAGAAAACAGTTAATAAAATGCATGCCTTCTGAACCAGAAACCATAAAAGCAAAACATGGGTCTCCAGCAACTGATGATGCTTGCCCTTTGAACCAGTGTGATTCTGTAGTGTTAAATGGAACAGTACCAACAAATGAAGTAATTGTCTCCACTTCAGAAGACCCTCTGGGTGGAGGTGATCCAACAGCACGTCATATAGAGATGGCAGCTTTGAAAGAAGGAGAGCCTGACTCCAGCAGTGATGCAGAGGAAGATAACTTATTTTTAACCCAAAATGATCCTGAAGATATGGATTTATGTTCACAAATGGAGAATGACAATTATAAACTCATTGAACTAATTCATGGAAAAGATACAGTTGAGGTTGAAGAAGATTCTGTAAGTCGGCCTCAGTTGGAATCTTTGAGTGGCACAAAGTGTAAGTACAAAGATTGTCTTGAAACCACAAAAAACCAGGGTGAATACTGCCCAAAACACTCTGAAGTGAAAGCAGCAGATGAAGATGTATTTCGTAAACCTGGCTTGCCTCCTCCTGCATCTAAACCTTTGAGACCTACCACTAAGATTTTTAGCTCAAAGAGTACTTCACGAATTGCTGGTCTTTCTAAATCTTTGGAAACTTCTTCAGCACTTTCACCGTCTCTAAAAAATAAGTCAAAGGGGATACAGTCGATTTTGAAAGTACCACAGCCAGTTCCCCTCATAGCTCAGAAGCCAGTTGGTGAAATGAAGAATTCGTGCAATGTTCTTCATCCTCAGTCTCCGAATAATTCCAACAGGCAAGGTTGCAAAGTTCCATTTGGTGAAAGCAAATATTTTCCATCTTCCTCTCCAGTAAACATTCTTTTGTCATCACAGTCTGTCTCTGACACCTTCGTTAAAGAGGTCTTAAAATGGAAATATGAAATGTTTTTGAACTTTGGTCAGTGTGGGCCCCCTGCAAGTCTTTGTCAGTCCATCTCAAGACCTGTGCCTGTCAGATTTCACAATTATGGAGATTATTTTAATGTTTTTTTCCCTTTGATGGTATTGAATACTTTTGAAACAGTGGCACAAGAATGGCTCAACTCTCCAAATAGAGAGAATTTCTATCAGTTGCAAGTACGAAAATTTCCTGCCGATTATATAAAATACTGGGAGTTTGCAGTTTATCTGGAAGAATGTGAACTGGCTAAACAGCTTTATCCAAAGGAAAACGATTTGGTGTTTTTAGCTCCTGAGAGAATAAATGAAGAGAAGAAAGATACAGAGAGAAATGACATACAAGATCTCCACGAATATCATTCTGGTTATGTTCATAAATTTCGCCGCACGTCAGTCATGCGTAATGGGAAAACTGAGTGTTACCTTTCCATCCAGACTCAAGAGAACTTTCCGGCCAATTTAAACGAACTTGTGAATTGTATTGTAATCAGTTCTCTGGTAACTACACAAAGGAAGTTGAAAGCCATGTCTCTGTTGGGTAGTCGGAACCAACTGGCTAGAGCTGTTCTGAATCCAAACCCTATGGACTTCTGTACAAAAGATTTACTGACTACAACATCTGAGAGAATTATTGCGTACTTAAGAGATTTCAATGAAGATCAAAAGAAAGCAATAGAAACTGCATATGCTATGGTGAAACACTCACCATCAGTTGCCAAAATCTGCTTGATTCATGGACCACCTGGAACAGGAAAATCAAAAACTATTGTTGGCCTCCTCTATCGTCTACTGACAGAGAACCAGAGGAAGGGGCATTCAGACGAAAACTCCAATGCCAAAATCAAACAAAACCGTGTCCTCGTGTGTGCACCTTCCAATGCAGCTGTTGATGAACTCATGAAAAAAATTATCCTTGAATTCAAAGAAAAATGTAAAGACAAGAAGAATCCTTTAGGAAACTGTGGAGATATAAATTTAGTACGACTGGGTCCAGAAAAGTCTATTAATAGTGAGGTTCTAAAGTTCAGTTTGGACAGCCAAGTAAACCACAGAATGAAAAAAGAGTTACCTTCTCATGTTCAGGCGATGCATAAAAGAAAGGAATTTCTAGATTATCAGCTGGATGAGCTTTCCCGGCAGCGAGCTCTATGCCGAGGTGGACGGGAAATACAGAGGCAAGAATTAGATGAAAACATTTCCAAAGTTTCTAAGGAAAGGCAGGAACTTGCTTCTAAAATTAAAGAGGTTCAAGGACGCCCACAGAAAACACAGAGTATCATCATCTTAGAGTCCCATATCATCTGCTGCACGTTGAGCACAAGTGGTGGTTTACTACTTGAGTCTGCTTTCCGTGGGCAAGGGGGTGTCCCCTTCAGCTGTGTCATTGTTGATGAGGCTGGACAGTCTTGTGAAATTGAGACTCTTACTCCACTCATCCATCGCTGCAATAAGCTCATCCTAGTAGGAGATCCTAAGCAGCTCCCTCCGACAGTCATCTCTATGAAAGCACAGGAGTATGGCTACGACCAGTCAATGATGGCTCGCTTCTGCAGACTGCTGGAAGAGAATGTAGAACACAACATGATCAGCAGGCTGCCCATTCTACAGCTCACTGTTCAGTACAGGATGCATCCAGACATATGCCTCTTCCCTTCTAATTATGTTTATAACAGAAACTTAAAAACAAATAGACAGACAGAAGCCATTCGATGTTCATCAGATTGGCCATTTCAGCCATACCTTGTGTTTGATGTTGGAGATGGTTCAGAAAGACGGGATAATGACTCATATATAAATGTTCAAGAAATAAAACTGGTGATGGAAATAATTAAGCTTATTAAAGACAAAAGAAAGGATGTTAGTTTTCGAAACATTGGCATAATAACTCATTACAAGGCCCAGAAGACGATGATTCAGAAGGATTTGGACAAAGAGTTCGATAGAAAAGGACCAGCAGAAGTAGACACTGTGGATGCATTCCAGGGTCGGCAGAAGGATTGTGTTATTGTTACGTGTGTCAGAGCAAATAGCATCCAAGGTTCAATTGGATTCCTGGCAAGTTTGCAGAGATTGAATGTCACCATCACACGAGCCAAGTACAGCCTCTTCATCCTCGGACATTTGAGGACCCTGATGGAAAACCAGCATTGGAATCAGCTGATTCAGGATGCTCAGAAGCGTGGTGCCATTATTAAGACCTGTGACAAAAACTATAGACATGATGCAGTGAAGATTCTGAAACTCAAGCCTGTGCTGCAGAGAAGTCTCACTCACCCTCCTACCATAGCCCCAGAGGGGTCCAGACCCCAGGGTGGTTTGCCCAGCAGCAAGCTAGACAGTGGATTTGCCAAGACATCTGTTGCTGCTTCTCTATACCACACACCCTCTGACTCCAAGGAAATTACTCTTACTGTTACTTCAAAGGACCCTGAAAGACCTCCTGTTCATGACCAACTTCAGGACCCACGACTGCTGAAGAGGATGGGCATTGAGGTCAAAGGAGGAATATTCCTTTGGGATCCACAACCCTCGAGCCCCCAGCATCCTGGAGCAACACCTCCTACGGGCGAGCCGGGCTTCCCTGTCGTTCACCAGGACCTGAGCCATATACAGCAGCCCGCTGCTGTAGTGGCTGCTCTGAGCAGCCACAAACCTCCCGTGCGGGGCGAACCTCCAGCTGCCAGTCCCGAGGCTTCCACGTGTCAGAGCAAATGTGATGACCCGGAAGAGGAGCTCTGTCACAGGAGAGAGGCCAGGGCTTTCAGTGAAGGGGAGCAGGAGAAGTGTGGTTCCGAGACCCATCACACCAGGAGGAACTCTAGGTGGGACAAGAGGACACTGGAGCAGGAGGACAGCAGTTCCAAGAAAAGAAAGCTTTTATAG

Back to List