Details for gene: VPS13D


protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; mitochondrion organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of a mitochondrion; includes mitochondrial morphogenesis and distribution, and replication of the mitochondrial genome as well as synthesis of new mitochondrial components. ; extracellular exosome : A vesicle that is released into the extracellular region by fusion of the limiting endosomal membrane of a multivesicular body with the plasma membrane. Extracellular exosomes, also simply called exosomes, have a diameter of about 40-100 nm. ; protein targeting to vacuole : The process of directing proteins towards the vacuole, usually using signals contained within the protein. ; extrinsic component of membrane : The component of a membrane consisting of gene products and protein complexes that are loosely bound to one of its surfaces, but not integrated into the hydrophobic region. ; positive regulation of mitophagy : Any process that activates or increases the frequency, rate or extent of mitophagy. ; protein retention in Golgi apparatus : The retention of proteins within the Golgi apparatus. Golgi-localized carbohydrate-modifying enzymes have a short N-terminal domain that faces the cytosol, a single transmembrane alpha helix, and a large C-terminal domain that faces the Golgi lumen and that contains the catalytic site. How the membrane-spanning alpha helix in a Golgi enzyme causes its localization and prevents its movement to the plasma membrane is not known. ;


Symbol
VPS13D
Name
vacuolar protein sorting 13 homolog D
Entrez ID
55187
Ensembl ID
ENSG00000048707    (more details)
KEGG ID
hsa:55187    (more details)
OMIM ID
607317
Uniprot ID
Q5THJ4  
GO ID
hsa:55187    (more details)
Chromosome
2
Strand
1
Start
131476119
End
131482934
miRNA Interactions
hsa-miR-30c-5p (RPM: 3890.0396) / hsa-miR-29b-3p (RPM: 118.8178) / hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-132-3p (RPM: 82.2598) / hsa-miR-29c-3p (RPM: 661.3514) / hsa-miR-30d-5p (RPM: 9562.1366) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-29a-3p (RPM: 1246.9046) / hsa-miR-30e-5p (RPM: 2305.0396) / hsa-miR-106b-5p (RPM: 35.4204) / hsa-miR-340-5p (RPM: 285.763) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-454-3p (RPM: 66.0634) / hsa-miR-3065-5p (RPM: 5.6206) / hsa-miR-30b-5p (RPM: 1466.5144) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-493-5p (RPM: 18.0762) / hsa-miR-381-3p (RPM: 109.8078) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-495-3p (RPM: 8.062) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-96-5p (RPM: 1417.2834) / hsa-miR-130a-3p (RPM: 723.372) / hsa-miR-130b-3p (RPM: 68.2014) / hsa-let-7e-5p (RPM: 3790.2074) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-301b-3p (RPM: 9.609) / hsa-miR-301a-3p (RPM: 142.8494) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-664a-3p (RPM: 65.4214) / hsa-miR-876-5p (RPM: 0.4744) / hsa-miR-432-5p (RPM: 29.044) / hsa-miR-10a-3p (RPM: 0.0878) / hsa-miR-142-5p (RPM: 245.4844) / hsa-miR-22-3p (RPM: 26348.475) / hsa-miR-181a-5p (RPM: 52364.6344) / hsa-miR-122-5p (RPM: 0.5028) / hsa-miR-4429 (RPM: 0.0238) / hsa-miR-320b (RPM: 35.0146) / hsa-miR-320c (RPM: 5.4174) / hsa-miR-320d (RPM: 3.9486) / hsa-miR-346 (RPM: 2.6286) / hsa-let-7g-3p (RPM: 7.0448) / hsa-miR-671-5p (RPM: 10.1036) / hsa-miR-342-5p (RPM: 28.1628) / hsa-miR-1246 (RPM: 1.4034) / hsa-miR-192-3p (RPM: 0.4144) / hsa-miR-642a-5p (RPM: 0.7748) / hsa-miR-556-3p (RPM: 0.5384) / hsa-miR-4723-3p (RPM: 0.089) / hsa-miR-31-5p (RPM: 310.1326) / hsa-miR-17-3p (RPM: 13.6088) / hsa-miR-146a-3p (RPM: 0.066) / hsa-miR-1271-5p (RPM: 29.1658) / hsa-miR-9-3p (RPM: 123.624) / hsa-miR-20a-3p (RPM: 0.8156) / hsa-miR-361-3p (RPM: 73.5598) / hsa-miR-16-2-3p (RPM: 15.7658) / hsa-miR-181a-2-3p (RPM: 1451.5764) / hsa-miR-504-5p (RPM: 27.4444) / hsa-miR-4685-3p (RPM: 0.7634) / hsa-miR-135b-3p (RPM: 2.2482) / hsa-miR-3667-3p (RPM: 0.0008) / hsa-miR-550a-3p (RPM: 2.5866) / hsa-miR-3183 (RPM: 0.3314) / hsa-miR-15b-3p (RPM: 6.693) / hsa-miR-616-3p (RPM: 0.3382) / hsa-miR-296-5p (RPM: 12.5874) / hsa-miR-500a-3p (RPM: 426.0306) / hsa-miR-1306-3p (RPM: 0.8504) / hsa-miR-8485 (RPM: 0.0894) / hsa-miR-6868-3p (RPM: 0.3062) / hsa-miR-6780a-3p (RPM: 0.023) / hsa-miR-6817-3p (RPM: 0.0036) / hsa-miR-5088-3p (RPM: 0.3748) / hsa-miR-6734-3p (RPM: 0.014) / hsa-miR-6728-3p (RPM: 0.0024) / hsa-miR-6881-3p (RPM: 0.2412) / hsa-miR-7106-3p (RPM: 0.0112) / hsa-miR-7111-3p (RPM: 0.0388) / hsa-miR-6769b-3p (RPM: 0.1724) /
Involved Diseases
Posterior capsule opacification (PCO) /
Involved Pathways
Mitochondrial protein import /
Sequence
ATGTTGGAAGGCCTTGTAGCCTGGGTTCTCAATACCTATTTGGGAAAATATGTCAATAACCTGAACACTGACCAGCTCTCAGTTGCACTTCTCAAAGGTGCTGTTGAATTAGAAAACTTGCCATTAAAGAAAGATGCCTTGAAAGAATTGGAATTACCATTTGAAGTCAAAGCTGGCTTCATTGGGAAAGTAACCCTTCAGATTCCCTTTTATCGCCCCCATGTGGACCCTTGGGTGATCTCCATCTCCAGCCTTCACTTAATTGGAGCCCCAGAGAAAATACAGGATTTCAATGATGAAAAGGAGAAGCTGTTGGAAAGGGAACGTAAGAAAGCACTACTTCAAGCCCTGGAGGAGAAATGGAAGAATGACCGCCAGCAGAAAGGGGAGTCCTATTGGTATTCAGTTACCGCCTCCGTAGTTACAAGGATTGTGGAGAATATTGAATTAAAAATTCAAGATGTCCATTTACGCTTTGAAGATGGTGTCACCAATCCCTCCCATCCTTTTGCTTTTGGCATCTGCATTAAGAATGTGTCCATGCAAAATGCTGTGAATGAGCCTGTACAGAAACTAATGCGGAAAAAGCAATTAGACGTAGCAGAATTTAGCATCTATTGGGATGTCGATTGCACTTTACTGGGGGATTTGCCTCAGATGGAGTTACAGGAGGCCATGGCCAGGAGCATGGAGAGTCGCAGCCATCACTACGTCCTGGAGCCTGTGTTTGCATCTGCTCTTTTGAAGAGAAACTGCTCCAAGAAGCCCCTGCGGTCTCGGCACAGTCCCCGTATTGATTGTGATATTCAGCTGGAGACCATTCCCTTGAAACTCTCTCAGCTGCAATACCGGCAAATCATGGAATTCCTCAAGGAGCTGGAACGAAAGGAGAGGCAGGTGAAGTTCCGAAGGTGGAAACCCAAGGTGGCGATATCTAAGAACTGCCGAGAATGGTGGTATTTTGCTTTGAATGCTAACTTGTATGAGATCAGAGAGCAGAGGAAACGTTGCACCTGGGACTTTATGTTGCACCGCGCTCGTGATGCTGTATCTTACACTGACAAATATTTCAACAAGTTAAAAGGAGGCCTGCTGTCCACAGATGACAAGGAGGAAATGTGTCGGATTGAAGAGGAACAGAGCTTTGAGGAATTGAAGATTTTGCGTGAACTGGTTCATGATCGATTTCACAAACAGGAAGAACTAGCAGAGAGTCTGCGGGAGCCTCAGTTTGATTCTCCAGGAGCCTGTCCGGGAGCCCCAGAACCCGGTGGAGGCAGTGGGATGCTGCAGTATCTCCAGTCCTGGTTTCCTGGATGGGGTGGCTGGTACGGGCAGCAGACCCCAGAAGGGAATGTGGTTGAGGGACTGTCAGCAGAGCAACAGGAGCAGTGGATTCCTGAAGAGATCCTGGGCACTGAGGAGTTTTTTGACCCCACTGCAGATGCCTCGTGTATGAACACGTATACAAAGCGAGATCATGTCTTTGCCAAACTGAATTTGCAGTTGCAGCGAGGTACAGTGACTCTGTTACACAAGGAGCAAGGAACTCCTCAAATGAATGAAAGTGCTTTCATGCAGCTCGAGTTTTCAGATGTAAAACTTCTAGCAGAGTCTCTTCCTCGAAGAAATTCCTCGTTGCTTTCAGTCCGGTTGGGTGGACTGTTTCTTCGAGACCTGGCTACAGAAGGAACTATGTTTCCTCTTCTAGTCTTCCCTAATCCACAAAAAGAAGTTGGCAGAGTCTCACAATCTTTTGGTCTACAAACTACATCTGCAGACAGAAGTGATCATTACCCAGCTGCAGATCCAGATGGCCCCGTTTTTGAGATGCTGTATGAGAGAAATCCGGCGCACAGCCACTTTGAGAGGCGGCTCAATGTCAGCACAAGGCCCTTGAACATCATATACAATCCGCAGGCCATTAAAAAAGTAGCAGACTTTTTCTACAAGGGAAAGGTTCATACCTCAGGTTTTGGTTATCAGTCTGAACTTGAGCTGAGAGTGGCTGAAGCTGCCCGAAGACAATATAACAAGCTGAAGATGCAGACCAAGGCAGAAATCCGGCAAACTCTTGATCGTTTGCTAGTGGGTGATTTCATTGAGGAGAGTAAACGATGGACCGTGCGGCTGGATATTTCTGCCCCTCAGGTGATATTTCCTGATGATTTCAAATTCAAGAATCCTGTGTTAGTTGTCGTGGATCTAGGAAGAATGCTTTTGACGAACACCCAAGATAACTCCAGGAGGAAAAGTAGGGATGGGTCAGCATCTGAAGAGACCCAGTTTAGTGATGATGAATATAAGACCCCCCTGGCCACACCTCCTAACACCCCACCTCCCGAGTCAAGCAGCAGCAACGGAGAGAAAACACCTCCCTTTTCTGGAGTTGAGTTCAGTGAAGAACAGCTTCAAGCACATTTAATGAGCACAAAGATGTATGAGAGGTACTCGCTGTCATTTATGGACCTCCAGATCATGGTTGGACGAGTGAAAGACAATTGGAAGCATGTCCAGGATATTGACGTGGGACCAACACATGTGGTAGAGAAGTTCAACGTTCACCTACAGTTAGAGCGTCGATTGATTTATACTTCAGATCCCAAATATCCAGGAGCCGTGCTCTCAGGCAACTTACCAGACTTAAAAATCCACATTAATGAAGATAAAATATCTGCACTAAAGAATTGCTTTGCTCTCCTCACCACCCCAGAAATGAAAACTTCTGACACTCAGATTAAAGAAAAGATTTTTCCCCAGGAGGAGCAGCGGGGAAGTTTGCAAGACTCCGTAATGAATTTAACCCAGAGCATTGTGTTGTTGGAGCAGCATACCCGCGAGGTTCTGGTGGAGTCGCAGCTCCTCCTGGCGGAATTTAAAGTGAACTGTATGCAGCTTGGTGTTGAGAGCAATGGCCGGTACATTTCTGTGCTCAAGGTGTTTGGTACCAATGCTCACTTTGTGAAGAGGCCTTATGATGCTGAAGTCTCCCTAACTGTTCATGGTTTGCTCCTGGTGGATACCATGCAGACATATGGTGCTGATTTTGACCTTTTGATGGCTTCACATAAGAACTTGAGCTTTGATATTCCAACGGGAAGCCTTCGGGATAGCAGGGCCCAGTCTCCTGTCTCTGGACCGAATGTGGCCCACTTAACTGATGGAGCTACACTGAACGACCGATCAGCTACTAGTGTTTCACTTGACAAAATTCTTACCAAAGAGCAAGAGTCCCTTATTAAGTTGGAATATCAGTTTGTGAGTTCAGAGTGCCCATCGATGAATTTAGACAGTACTCTTCAGGTGATTTCCCTACAGGTGAATAATTTAGATATTATCCTCAATCCAGAGACGATTGTGGAGCTAATTGGTTTTCTTCAAAAATCCTTTCCCAAGGAAAAAGATGATTTAAGTCCTCAACCTTTAATGACTGATTTTGAAAGAAGCTTCAGAGAACAAGGAACTTACCAGTCTACATATGAACAAAACACTGAGGTTGCAGTGGAAATCCATAGGCTGAACTTACTGCTTCTTCGGACAGTGGGCATGGCAAATAGAGAGAAATATGGCAGAAAAATTGCAACTGCAAGTATAGGTGGCACCAAAGTTAATGTCTCAATGGGTAGCACGTTTGACATGAATGGTTCTCTTGGCTGTTTACAGCTTATGGATTTGACACAAGATAACGTTAAAAACCAGTATGTTGTCAGCATTGGGAATTCTGTAGGCTATGAAAATATCATCAGTGATATTGGCTACTTTGAATCTGTGTTTGTCAGAATGGAAGATGCAGCCCTCACTGAAGCTTTGAGTTTCACGTTTGTTGAGAGATCTAAACAGGAGTGTTTTCTCAACCTGAAGATGGCTTCTTTACATTATAACCACTCTGCTAAGTTTTTGAAGGAGTTGACGTTATCCATGGATGAACTGGAAGAAAATTTTCGAGGTATGCTGAAAAGCGCAGCCACCAAAGTCACCACAGTACTAGCTACCAAGACTGCCGAGTATAGCGAGATGGTATCGCTCTTTGAAACTCCAAGGAAGACTCGGGAACCCTTTATCTTAGAGGAAAATGAAATATATGGGTTTGACCTAGCTTCGTCTCATTTGGACACTGTAAAGCTAATCTTGAACATAAACATTGAATCACCAGTTGTTTCTATCCCTCGGAAGCCGGGGAGTCCTGAGTTGTTGGTGGGACACTTGGGACAGATATTCATCCAGAATTTTGTGGCGGGAGATGATGAATCCAGAAGTGACCGTCTGCAGGTGGAAATCAAGGACATTAAACTGTATTCTTTGAATTGCACCCAGTTGGCAGGTAGAGAAGCTGTTGGGTCTGAAGGAAGCCGGATGTTTTGCCCACCTTCCGGGTCTGGCAGTGCCAACAGTCAGGAGGAAGCTCATTTCACACGACATGATTTCTTTGAATCTTTGCATAGAGGTCAAGCTTTTCACATCCTGAACAACACCACCATTCAGTTTAAACTGGAGAAGATCCCTATAGAGAGAGAATCTGAATTGACTTTTTCTCTTAGCCCAGATGACCTGGGAACTTCTAGCATCATGAAGATTGAAGGAAAATTTGTCAATCCAGTTCAGGTGGTGTTAGCAAAGCATGTATATGAGCAGGTTTTACAAACCCTGGACAATCTCGTGTACAGTGAAGATCTGAATAAGTATCCAGCCAGTGCTACCTCCTCCCCTTGCCCTGATTCTCCTCTGCCTCCCCTCAGTACCTGTGGAGAATCTTCTGTTGAAAGGAAGGAGAATGGATTGTTCAGCCACTCCAGCCTTTCTAACACCTCTCAGAAGTCATTGTCAGTGAAGGAAGTCAAATCCTTTACTCAGATTCAAGCCACCTTTTGTATATCAGAGCTTCAGGTTCAGCTAAGTGGAGATCTGACTTTGGGGGCCCAAGGTCTTGTGAGCTTAAAGTTTCAGGACTTTGAGGTGGAATTCAGTAAAGACCATCCCCAGACTTTATCTATTCAGATTGCCCTGCATTCTCTGCTGATGGAGGACTTATTGGAGAAGAATCCAGATTCTAAATATAAGAACCTGATGGTGTCTCGAGGAGCCCCTAAGCCATCTAGTTTAGCACAAAAAGAATACCTTTCTCAGTCTTGCCCCTCAGTGTCCAATGTGGAATATCCTGATATGCCTCGGTCTCTCCCTTCCCACATGGAAGAAGCTCCTAATGTCTTCCAGTTGTATCAAAGGCCCACCTCTGCGTCCCGGAAAAAGCAAAAGGAAGTCCAAGACAAGGACTATCCCTTGACCCCACCTCCTTCTCCAACAGTGGATGAGCCCAAGATACTTGTTGGAAAGAGTAAATTTGATGATTCCTTAGTCCACATCAACATATTCTTGGTAGATAAGAAACATCCAGAATTCTCTTCCAGTTACAATCGAGTTAACCGGAGCATTGATGTTGATTTTAATTGCTTGGATGTGCTGATCACACTGCAAACCTGGGTTGTGATATTAGACTTTTTTGGAATCGGCTCCACTGCAGACAACCACGCAATGAGGCTGCCTCCTGAGGGCATTCTGCACAACGTGAAGTTGGAGCCACATGCCTCCATGGAGTCTGGACTTCAGGATCCAGTGAACACCAAACTGGATCTCAAGGTTCATTCACTTTCTCTAGTGCTGAATAAGACCACCAGTGAGCTTGCCAAAGCAAATGTGTCCAAATTAGTAGCACACCTGGAAATGATTGAGGGAGACCTGGCCTTACAGGGCAGCATTGGGAGTCTGTCTCTAAGTGACCTCACATGCCATGGAGAGTTCTACAGAGAACGGTTCACTACCAGTGGTGAAGAAGCACTCATCTTCCAGACTTTTAAATACGGACGGCCTGACCCTCTGCTCCGGAGAGAACACGACATTCGCGTGAGCCTCCGGATGGCCTCTGTGCAGTATGTGCATACTCAGCGTTTCCAGGCAGAGGTGGTGGCCTTCATTCAGCATTTCACTCAGCTGCAGGATGTCTTAGGGCGCCAGCGAGCTGCTATTGAGGGGCAGACGGTGAGAGATCAAGCCCAGCGCTGTTCACGGGTTCTCCTGGATATTGAGGCTGGTGCTCCCGTTCTCTTGATCCCAGAAAGTTCCAGATCAAATAATCTGATTGTAGCAAATTTGGGGAAGTTGAAAGTCAAAAATAAGTTTCTGTTTGCTGGTTTTCCTGGCACCTTTTCCCTACAAGATAAGGAATCTGTGCCTTCAGCTTCCCCAACGGGTATTCCCAAACACAGTCTGAGGAAAACGACAAGCACGGAGGAGCCCAGGGGAACCCATTCCCAGGGGCAGTTCACGATGCCTCTTGCTGGAATGAGCCTAGGAAGCCTGAAGAGTGAGTTTGTGCCCAGTACCTCCACCAAGCAGCAAGGGCCGCAACCCACACTGTCTGTTGGCCAAGAGTCCAGTAGTCCAGAAGACCATGTCTGCCTGCTGGATTGCGTTGTCGTGGATCTCCAGGACATGGACATCTTTGCTGCAGAGAGACATCCGAGAGAATACTCGAAGGCACCAGAGGATAGTAGTGGAGATCTGATCTTCCCTTCCTATTTTGTGCGACAGACAGGAGGAAGCCTCTTAACCGAGCCTTGTAGGCTGAAATTGCAGGTGGAAAGGAATTTGGACAAAGAAATAAGTCATACTGTGCCAGACATATCTATCCATGGCAATCTCTCCTCAGTCCACTGCTCTCTGGATCTGTATAAATACAAGCTGATCCGCGGCTTATTAGAGAACAACCTGGGAGAACCCATAGAGGAATTTATGCGGCCTTATGATTTACAAGATCCAAGAATTCATACTGTCCTGAGTGGAGAAGTGTACACCTGTATGTGCTTCCTCATTGATATGGTGAATGTAAGTCTGGAGCTTAAAGATCCAAAAAGAAAAGAAGGTGCTGGGTCCCTAGCCAGATTTGACTTCAAGAAATGCAAACTGCTCTATGAAAGTTTTTCCAACCAAACCAAGTCCATTAACTTGGTTTCCCATTCCATGATGGCTTTTGACACCCGTTATGCTGGGCAGAAGACCAGCCCTGGCATGACGAATGTGTTCAGCTGTATCTTTCAGCCCGCTAAGAACAGCAGCACCACCCAAGGGTCCATTCAGATTGAACTACATTTCAGATCTACCAAGGATTCCTCCTGCTTTACAGTAGTTCTCAACAATCTCCGTGTGTTTCTCATATTTGACTGGCTACTGTTAGTCCATGATTTTCTCCACACTCCCAGTGATATTAAGAAACAAAATCATGTTACTCCTTCTCGCCACCGTAACTCTAGCAGCGAATCTGCTATAGTTCCCAAAACTGTGAAGAGTGGAGTAGTTACCAAGCGGTCTTCCCTTCCTGTGTCCAATGAAAGGCACCTGGAGGTCAAGGTCAATGTAACAGGTACGGAGTTTGTGGTCATTGAAGATGTGTCCTGCTTCGACACCAATGCCATTATTCTGAAAGGCACCACAGTGCTCACCTATAAGCCCCGGTTTGTTGATCGCCCCTTTTCAGGAAGTTTGTTTGGCATTGAGGTGTTTTCATGCCGACTAGGGAATGAGCATGATACAGCTCTTTCAATTGTGGATCCCGTACAAATTCAAATGGAGTTGGTGGGGAATTCTTCTTATCAAAATAGTTCAGGATTGATGGATGCATTCAATAGTGAAGATTTCCCACCTGTCCTGGAGATTCAGTTACAAGCCCTGGATATCAGACTCTCCTATAATGATGTTCAGCTGTTTCTTGCCATTGCAAAATCCATCCCAGAGCAAGCTAATGCTGCAGTGCCAGACTCAGTGGCCCTGGAGTCAGACTCCGTTGGCACTTACCTTCCAGGTGCATCTCGCGTTGGAGAGGAAATCAGAGAAGGGACAAGACACACCTTAGATCCTGTCTTGGAGTTACAGCTGGCTAGGCTGCAGGAGCTGGGATTCAGCATGGATGATTGTCGCAAAGCTCTTTTGGCGTGTCAAGGCCAATTGAAAAAGGCAGCAAGTTGGTTGTTTAAGAATGCGGAACCTCTGAAGTCTCTTTCCTTGGCCTCCACCAGCCGAGATAGCCCAGGGGCTGTGGCAGCGCCATTGATCTCTGGCGTGGAGATCAAAGCTGAGAGTGTGTGCATCTGTTTCATCGATGACTGCATGGATTGTGATGTTCCTCTCGCTGAACTCACCTTTTCCCGTCTGAATTTTCTTCAGCGTGTAAGAACTAGCCCTGAAGGCTATGCCCACTTCACCCTTTCTGGAGATTATTATAACCGTGCTCTTTCAGGCTGGGAGCCATTTATTGAGCCTTGGCCATGCTCTGTATCCTGGCAACAGCAGGCAGCTAGTCGTCTCCATCCTCCTCGACTGAAGCTAGAAGCCAAGGCCAAACCTCGTTTGGATATCAATATCACTTCTGTGCTAATTGACCAGTATGTAAGTACCAAGGAATCGTGGATGGCAGATTACTGTAAAGATGACAAGGACATAGAGTCAGCTAAATCAGAAGACTGGATGGGCTCTTCGGTGGATCCTCCATGTTTTGGACAAAGCCTCCCCCTTGTCTACCTTAGAACTAGGAGTACAGCCAGTCTGACTAACCTAGAGCACCAGATCTATGCTAGAGCAGAGGTGAAAACCCCCAAGCGCCGGCAGCCATTTGTCCCCTTTGCTCTGAGGAACCACACGGGGTGCACTTTGTGGTTTGCCACCCTGACCACCACACCCACCAGAGCTGCACTCTCTCACAGTGGGAGTCCAGGGGTAGTTCCAGAAGGGAACGGAACATTTCTCGATGATACTCACAATGTTAGTGAATGGCGAGAAGTCCTTACAGGTGAAGAGATTCCCTTTGAATTTGAAGCAAGAGGAAAGTTAAGACACAGACACACCCATGACCTCCGGATTCATCAACTGCAAGTGAGAGTAAATGGCTGGGAGCAAGTGAGCCCAGTGTCTGTGGACAAAGTCGGGACCTTTTTTCGATATGCAGCACCAGATAAAAATTCATCTTCCTCTACGATTGGCAGCCCAAGCAGCAGAACAAATATTATACATCCCCAGGTTTATTTCTCTTCACTCCCACCAGTGCGGGTGGTCTTTGCAGTGACTATGGAAGGCAGTGCACGGAAAGTCATCACTGTCCGGTCAGCCCTCATTGTGAGGAACAGACTTGAGACACCAATGGAACTAAGACTGGATAGCCCATCAGCTCCAGACAAGCCAGTGGTGCTTCCTGCTATCATGCCAGGGGATTCGTTTGCTGTGCCTTTACACCTCACTTCTTGGCGGCTACAGGCCCGGCCCAAAGGATTGGGTGTATTTTTCTGTAAGGCTCCCATTCATTGGACCAATGTAGTGAAGACTGCAGAAATTAGTAGCAGTAAACGAGAGTGCCACTCTATGGACACAGAAAAAAGCCGATTTTTCAGGTTTTGTGTGGCTATAAAGAAAGAGAATTATCCAGATTATATGCCCTCAAACATATTTTCTGACAGTGCAAAACAGATTTTCAGACAGCCTGGGCATACCATATATCTCCTGCCAACTGTGGTAATCTGCAACTTGCTACCCTGTGAACTTGATTTTTATGTTAAAGGAATGCCAATTAATGGGACGCTGAAACCTGGCAAGGAGGCAGCTCTCCATACAGCTGATACATCCCAGAACATTGAGCTGGGGGTATCACTGGAGAATTTCCCCCTCTGTAAAGAATTGCTCATTCCACCTGGAACCCAAAACTATATGGTGAGAATGCGACTCTATGACGTCAACCGTCGGCAGCTGAACCTCACCATCCGGATTGTGTGTCGAGCAGAAGGATCCTTAAAGATCTTCATTTCTGCTCCATATTGGCTGATTAACAAAACAGGGTTGCCACTGATCTTCAGACAGGACAATGCCAAGACAGATGCTGCAGGCCAGTTTGAGGAGCATGAGCTGGCCCGTAGCCTGAGTCCTCTCTTATTCTGCTATGCTGACAAAGAGCAGCCAAACCTCTGCACGATGAGAATCGGAAGGGGGATTCATCCAGAAGGCATGCCGGGCTGGTGTCAGGGCTTCTCCCTGGATGGTGGTAGTGGTGTCCGAGCTTTGAAAGTCATCCAGCAAGGAAACCGCCCAGGGCTGATCTATAACATTGGTATTGATGTCAAGAAAGGCCGAGGTCGATACATTGATACCTGCATGGTCATCTTTGCCCCCCGTTACCTGTTAGATAATAAATCATCTCACAAGCTTGCATTTGCACAGAGGGAATTTGCCAGGGGACAGGGAACAGCCAATCCCGAAGGTTACATTTCCACCCTTCCTGGTTCCAGTGTGGTGTTCCACTGGCCTCGGAATGACTATGATCAGCTATTGTGTGTCAGACTGATGGACGTTCCCAATTGTATTTGGTCTGGAGGCTTTGAAGTCAACAAGAATAATTCCTTCCATATCAACATGAGGGATACCTTGGGAAAATGCTTCTTCCTACGAGTGGAAATTACTCTCCGAGGAGCTACGTATAGGATCTCATTTAGTGACACAGATCAGTTACCTCCTCCTTTCCGAATTGACAACTTTTCTAAGGTCCCGGTTGTCTTTACTCAGCATGGCGTAGCTGAACCCAGGCTCCGGACTGAAGTGAAGCCCATGACTTCATTGGATTATGCCTGGGACGAACCCACCTTGCCACCTTTTATCACTCTGACTGTTAAAGGGGCAGGGTCCTCTGAGATCAACTGCAACATGAATGATTTCCAGGATAATCGGCAGCTTTATTATGAAAATTTCATTTACATTGCTGCTACATATACATTCTCTGGCTTGCAGGAGGGAACAGGCAGGCCTGTGGCTTCCAACAAGGCCATTACCTGTGCGGAGCTCGTTTTGGATGTCTCACCCAAGACACAAAGAGTCATTTTAAAAAAGAAGGAACCAGGAAAGCGTTCTCAGCTGTGGAGGATGACAGGAACAGGAATGCTGGCCCATGAGGGCTCCTCAGTTCCTCACAATCCCAATAAGCCCTCAGCCGCCCGCTCCACCGAGGGGTCTGCCATCTTAGATATTGCTGGTCTCGCTGCAGTGACTGACAACAGATACGAGCCACTGATGCTGAGAAAGCCTGACCGCAGGCGAAGCACAACTCAGACGTGGAGTTTCCGAGAAGGAAAACTGACCTGTGGGTTACATGGGTTGGTCGTCCAGGCCAAAGGAGGACTTTCTGGTTTGTTTGATGGAGCTGAAGTTGTTCTTGGTCCTGACACTTCCATGGAGCTTTTGGGGCCAGTTCCACCTGAACAACAATTTATTAATCAAAAAATGAGACCTGGTTCTGGAATGTTATCCATCAGAGTCATCCCAGATGGACCAACTAGAGCACTCCAGATAACAGATTTCTGCCACCGGAAAAGCAGCCGTTCATATGAAGTGGATGAACTTCCTGTCACCGAACAAGAGCTGCAGAAATTAAAGAATCCAGATACAGAGCAGGAATTGGAAGTGCTTGTGAGGTTAGAAGGTGGAATTGGGTTGTCCTTAATTAATAAAGTCCCAGAAGAACTGGTCTTTGCAAGTCTTACAGGAATCAATGTGCACTATACACAGCTGGCAACCAGTCACATGCTTGAACTCAGCATACAGGATGTACAGGTGGACAATCAGCTCATTGGTACCACGCAGCCCTTCATGCTCTATGTGACTCCCCTGAGCAATGAGAATGAGGTCATCGAGACCGGCCCAGCTGTGCAAGTCAACGCAGTGAAGTTCCCCAGTAAGAGTGCACTGACCAACATCTACAAGCATCTGATGATCACAGCTCAGAGATTCACAGTGCAAATTGAGGAGAAACTGCTCCTCAAGCTGCTAAGTTTCTTTGGCTACGATCAAGCAGAATCAGAGGTGGAAAAATATGATGAAAACCTCCATGAAAAGACAGCTGAGCAAGGTGGAACACCAATTCGATACTACTTTGAAAATCTCAAAATCAGCATTCCTCAGATCAAGCTAAGTGTGTTCACCTCCAACAAGCTCCCATTGGATCTTAAGGCCCTAAAAAGCACCTTGGGGTTTCCTTTGATACGGTTTGAAGACGCTGTGATTAATCTAGATCCATTCACTCGGGTACATCCCTATGAGACCAAGGAGTTCATCATCAATGATATCCTCAAACATTTCCAGGAGGAACTCCTCAGCCAGGCAGCTCGAATCCTGGGATCAGTGGATTTTCTTGGCAATCCTATGGGGCTTTTGAATGATGTTTCTGAAGGGGTTACTGGACTGATAAAATATGGAAATGTCGGGGGCCTCATCAGAAATGTTACACACGGAGTATCAAACTCTGCTGCCAAGTTTGCTGGAACATTATCAGATGGCTTAGGGAAGACGATGGACAATCGGCATCAGTCAGAGCGGGAGTACATCAGGTACCATGCAGCCACAAGTGGTGAACACCTTGTAGCCGGCATCCATGGCCTGGCTCATGGTATCATTGGTGGACTGACCAGTGTTATAACTTCGACAGTGGAAGGTGTGAAAACAGAAGGGGGTGTCAGCGGTTTCATATCTGGCCTTGGAAAAGGGCTTGTTGGCACTGTAACCAAGCCAGTGGCAGGCGCCCTGGATTTTGCATCAGAAACAGCCCAGGCGGTGAGAGACACAGCCACACTCAGCGGCCCCAGGACTCAAGCACAGAGGGTTCGGAAACCGCGTTGCTGCACGGGGCCCCAGGGGCTGCTTCCCCGATATTCTGAGAGCCAGGCGGAAGGACAGGAGCAGCTCTTCAAACTCACAGACAACATACAGGACGAATTCTTCATCGCTGTGGAGAACATTGACAGCTACTGCGTGCTCATCTCCTCCAAAGCTGTTTACTTCCTGAAAAGTGGAGACTACGTGGATCGAGAAGCCATTTTCCTAGAAGTCAAATACGATGACCTCTACCACTGCCTTGTCTCCAAAGACCATGGGAAGGTGTATGTGCAGGTGACCAAGAAAGCCGTGAGCACGAGCAGTGGAGTGTCCATCCCCGGCCCCTCCCACCAGAAGCCCATGGTCCATGTGAAATCTGAGGTCCTTGCTGTCAAGTTGTCACAAGAAATAAACTACGCAAAGAGCCTCTACTATGAACAGCAGCTTATGTTAAGACTCAGCGAAAACCGAGAGCAGCTGGAGCTGGACTCCTGA

Back to List