Details for gene: TPP1


proteolysis : The hydrolysis of proteins into smaller polypeptides and/or amino acids by cleavage of their peptide bonds. ; serine-type peptidase activity : Catalysis of the hydrolysis of peptide bonds in a polypeptide chain by a catalytic mechanism that involves a catalytic triad consisting of a serine nucleophile that is activated by a proton relay involving an acidic residue (e.g. aspartate or glutamate) and a basic residue (usually histidine). ; serine-type endopeptidase activity : Catalysis of the hydrolysis of internal, alpha-peptide bonds in a polypeptide chain by a catalytic mechanism that involves a catalytic triad consisting of a serine nucleophile that is activated by a proton relay involving an acidic residue (e.g. aspartate or glutamate) and a basic residue (usually histidine). ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; Golgi apparatus : A membrane-bound cytoplasmic organelle of the endomembrane system that further processes the core oligosaccharides (e.g. N-glycans) added to proteins in the endoplasmic reticulum and packages them into membrane-bound vesicles. The Golgi apparatus operates at the intersection of the secretory, lysosomal, and endocytic pathways. ; peptidase activity : Catalysis of the hydrolysis of a peptide bond. A peptide bond is a covalent bond formed when the carbon atom from the carboxyl group of one amino acid shares electrons with the nitrogen atom from the amino group of a second amino acid. ; hydrolase activity : Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3. ; membrane raft : Any of the small (10-200 nm), heterogeneous, highly dynamic, sterol- and sphingolipid-enriched membrane domains that compartmentalize cellular processes. Small rafts can sometimes be stabilized to form larger platforms through protein-protein and protein-lipid interactions. ; lysosome : A small lytic vacuole that has cell cycle-independent morphology and is found in most animal cells and that contains a variety of hydrolases, most of which have their maximal activities in the pH range 5-6. The contained enzymes display latency if properly isolated. About 40 different lysosomal hydrolases are known and lysosomes have a great variety of morphologies and functions. ; melanosome : A tissue-specific, membrane-bounded cytoplasmic organelle within which melanin pigments are synthesized and stored. Melanosomes are synthesized in melanocyte cells. ; nervous system development : The process whose specific outcome is the progression of nervous tissue over time, from its formation to its mature state. ; recycling endosome : An organelle consisting of a network of tubules that functions in targeting molecules, such as receptors transporters and lipids, to the plasma membrane. ; tripeptidyl-peptidase activity : Catalysis of the release of an N-terminal tripeptide from a polypeptide. ; endopeptidase activity : Catalysis of the hydrolysis of internal, alpha-peptide bonds in a polypeptide chain. ; extracellular exosome : A vesicle that is released into the extracellular region by fusion of the limiting endosomal membrane of a multivesicular body with the plasma membrane. Extracellular exosomes, also simply called exosomes, have a diameter of about 40-100 nm. ; central nervous system development : The process whose specific outcome is the progression of the central nervous system over time, from its formation to the mature structure. The central nervous system is the core nervous system that serves an integrating and coordinating function. In vertebrates it consists of the brain and spinal cord. In those invertebrates with a central nervous system it typically consists of a brain, cerebral ganglia and a nerve cord. ; epithelial cell differentiation : The process in which a relatively unspecialized cell acquires specialized features of an epithelial cell, any of the cells making up an epithelium. ; lysosomal lumen : The volume enclosed within the lysosomal membrane. ; lipid metabolic process : The chemical reactions and pathways involving lipids, compounds soluble in an organic solvent but not, or sparingly, in an aqueous solvent. Includes fatty acids; neutral fats, other fatty-acid esters, and soaps; long-chain (fatty) alcohols and waxes; sphingoids and other long-chain bases; glycolipids, phospholipids and sphingolipids; and carotenes, polyprenols, sterols, terpenes and other isoprenoids. ; lysophosphatidic acid binding : Interacting selectively and non-covalently with lysophosphatidic acid (LPA), a phospholipid derivative that acts as a potent mitogen due to its activation of high-affinity G protein-coupled receptors. ; peptide binding : Interacting selectively and non-covalently with peptides, any of a group of organic compounds comprising two or more amino acids linked by peptide bonds. ; sulfatide binding : Interacting selectively and non-covalently with sulfatide, also known as 3-O-sulfogalactosylceramide, SM4, or sulfated galactocerebroside. Sulfatide is a class of sulfoglycolipid, which are glycolipids that contain a sulfate group. ; lysosome organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of a lysosome. A lysosome is a cytoplasmic, membrane-bounded organelle that is found in most animal cells and that contains a variety of hydrolases. ; protein catabolic process : The chemical reactions and pathways resulting in the breakdown of a protein by the destruction of the native, active configuration, with or without the hydrolysis of peptide bonds. ; peptide catabolic process : The chemical reactions and pathways resulting in the breakdown of peptides, compounds of 2 or more (but usually less than 100) amino acids where the alpha carboxyl group of one is bound to the alpha amino group of another. ; bone resorption : The process in which specialized cells known as osteoclasts degrade the organic and inorganic portions of bone, and endocytose and transport the degradation products. ; neuromuscular process controlling balance : Any process that an organism uses to control its balance, the orientation of the organism (or the head of the organism) in relation to the source of gravity. In humans and animals, balance is perceived through visual cues, the labyrinth system of the inner ears and information from skin pressure receptors and muscle and joint receptors. ; protein localization to chromosome, telomeric region : Any process in which a protein is transported to, or maintained at, the telomeric region of a chromosome. ; lysosomal protein catabolic process : Any cellular protein catabolic process that takes place in a lysosome. ;


Symbol
TPP1
Name
tripeptidyl peptidase 1
Entrez ID
1200
Ensembl ID
ENSG00000166340    (more details)
KEGG ID
hsa:1200    (more details)
OMIM ID
204500
Uniprot ID
O14773  
GO ID
hsa:1200    (more details)
Chromosome
1
Strand
-1
Start
12230030
End
12512047
miRNA Interactions
hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-30d-5p (RPM: 9562.1366) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-30e-5p (RPM: 2305.0396) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-27b-3p (RPM: 22876.2392) / hsa-miR-454-3p (RPM: 66.0634) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-106a-5p (RPM: 7.9736) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-19b-3p (RPM: 197.0578) / hsa-miR-19a-3p (RPM: 25.4064) / hsa-miR-2110 (RPM: 10.1142) / hsa-miR-138-5p (RPM: 67.2828) / hsa-miR-4671-3p (RPM: 0.1756) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-579-3p (RPM: 0.0084) / hsa-let-7f-5p (RPM: 17066.6836) / hsa-let-7c-5p (RPM: 4028.6728) / hsa-miR-130a-3p (RPM: 723.372) / hsa-miR-200c-3p (RPM: 348.3196) / hsa-miR-378a-5p (RPM: 22.027) / hsa-miR-23b-5p (RPM: 1.333) / hsa-let-7i-5p (RPM: 2025.2084) / hsa-miR-130b-3p (RPM: 68.2014) / hsa-miR-98-5p (RPM: 1660.0964) / hsa-let-7e-5p (RPM: 3790.2074) / hsa-let-7g-5p (RPM: 3559.4376) / hsa-miR-4725-3p (RPM: 0.1912) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-miR-3619-5p (RPM: 0.0804) / hsa-miR-497-3p (RPM: 0.4852) / hsa-miR-301b-3p (RPM: 9.609) / hsa-miR-301a-3p (RPM: 142.8494) / hsa-miR-455-3p (RPM: 82.7264) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-876-3p (RPM: 0.2528) / hsa-miR-214-3p (RPM: 21.2784) / hsa-miR-1296-5p (RPM: 36.5114) / hsa-miR-3191-3p (RPM: 0.0142) / hsa-miR-204-5p (RPM: 265062.0076) / hsa-miR-143-3p (RPM: 93089.5152) / hsa-miR-3150a-3p (RPM: 0.0248) / hsa-miR-211-5p (RPM: 11706.6776) / hsa-miR-219b-3p (RPM: 0.1282) / hsa-miR-127-3p (RPM: 3339.395) / hsa-miR-580-3p (RPM: 0.1496) / hsa-miR-22-3p (RPM: 26348.475) / hsa-miR-92a-1-5p (RPM: 8.113) / hsa-miR-502-5p (RPM: 0.9904) / hsa-miR-193a-3p (RPM: 13.6064) / hsa-miR-3174 (RPM: 0.2344) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-122-5p (RPM: 0.5028) / hsa-miR-193b-3p (RPM: 184.968) / hsa-miR-33a-5p (RPM: 5.9422) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-199a-3p (RPM: 731.3038) / hsa-miR-421 (RPM: 76.7678) / hsa-miR-219a-2-3p (RPM: 0.3508) / hsa-miR-1915-5p (RPM: 0.0172) / hsa-miR-769-3p (RPM: 3.6276) / hsa-miR-493-3p (RPM: 6.665) / hsa-miR-382-5p (RPM: 9.8234) / hsa-miR-769-5p (RPM: 505.4938) / hsa-miR-342-3p (RPM: 685.7862) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-425-5p (RPM: 187.631) / hsa-miR-628-3p (RPM: 10.2162) / hsa-miR-17-5p (RPM: 83.6404) / hsa-miR-33b-5p (RPM: 5.2366) / hsa-miR-744-5p (RPM: 290.9362) / hsa-miR-877-5p (RPM: 44.6348) / hsa-miR-296-3p (RPM: 8.5012) / hsa-miR-99b-3p (RPM: 43.962) / hsa-miR-92b-5p (RPM: 11.919) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-191-5p (RPM: 12993.8088) / hsa-miR-184 (RPM: 53035.2238) / hsa-miR-151a-3p (RPM: 2381.562) / hsa-miR-450a-2-3p (RPM: 0.021) / hsa-miR-6780b-5p (RPM: 0.0222) / hsa-miR-6763-5p (RPM: 0.1166) / hsa-miR-6516-5p (RPM: 0.859) / hsa-miR-6841-3p (RPM: 0.0012) / hsa-miR-6857-5p (RPM: 0.0034) / hsa-miR-6810-5p (RPM: 0.1892) / hsa-miR-6716-5p (RPM: 0.0062) / hsa-miR-6513-3p (RPM: 0.4952) /
Involved Diseases
Posterior capsule opacification (PCO) /
Involved Pathways
Sequence
ATGGGACTCCAAGCCTGCCTCCTAGGGCTCTTTGCCCTCATCCTCTCTGGCAAATGCAGTTACAGCCCGGAGCCCGACCAGCGGAGGACGCTGCCCCCAGGCTGGGTGTCCCTGGGCCGTGCGGACCCTGAGGAAGAGCTGAGTCTCACCTTTGCCCTGAGACAGCAGAATGTGGAAAGACTCTCGGAGCTGGTGCAGGCTGTGTCGGATCCCAGCTCTCCTCAATACGGAAAATACCTGACCCTAGAGAATGTGGCTGATCTGGTGAGGCCATCCCCACTGACCCTCCACACGGTGCAAAAATGGCTCTTGGCAGCCGGAGCCCAGAAGTGCCATTCTGTGATCACACAGGACTTTCTGACTTGCTGGCTGAGCATCCGACAAGCAGAGCTGCTGCTCCCTGGGGCTGAGTTTCATCACTATGTGGGAGGACCTACGGAAACCCATGTTGTAAGGTCCCCACATCCCTACCAGCTTCCACAGGCCTTGGCCCCCCATGTGGACTTTGTGGGGGGACTGCACCGTTTTCCCCCAACATCATCCCTGAGGCAACGTCCTGAGCCGCAGGTGACAGGGACTGTAGGCCTGCATCTGGGGGTAACCCCCTCTGTGATCCGTAAGCGATACAACTTGACCTCACAAGACGTGGGCTCTGGCACCAGCAATAACAGCCAAGCCTGTGCCCAGTTCCTGGAGCAGTATTTCCATGACTCAGACCTGGCTCAGTTCATGCGCCTCTTCGGTGGCAACTTTGCACATCAGGCATCAGTAGCCCGTGTGGTTGGACAACAGGGCCGGGGCCGGGCCGGGATTGAGGCCAGTCTAGATGTGCAGTACCTGATGAGTGCTGGTGCCAACATCTCCACCTGGGTCTACAGTAGCCCTGGCCGGCATGAGGGACAGGAGCCCTTCCTGCAGTGGCTCATGCTGCTCAGTAATGAGTCAGCCCTGCCACATGTGCATACTGTGAGCTATGGAGATGATGAGGACTCCCTCAGCAGCGCCTACATCCAGCGGGTCAACACTGAGCTCATGAAGGCTGCCGCTCGGGGTCTCACCCTGCTCTTCGCCTCAGGTGACAGTGGGGCCGGGTGTTGGTCTGTCTCTGGAAGACACCAGTTCCGCCCTACCTTCCCTGCCTCCAGCCCCTATGTCACCACAGTGGGAGGCACATCCTTCCAGGAACCTTTCCTCATCACAAATGAAATTGTTGACTATATCAGTGGTGGTGGCTTCAGCAATGTGTTCCCACGGCCTTCATACCAGGAGGAAGCTGTAACGAAGTTCCTGAGCTCTAGCCCCCACCTGCCACCATCCAGTTACTTCAATGCCAGTGGCCGTGCCTACCCAGATGTGGCTGCACTTTCTGATGGCTACTGGGTGGTCAGCAACAGAGTGCCCATTCCATGGGTGTCCGGAACCTCGGCCTCTACTCCAGTGTTTGGGGGGATCCTATCCTTGATCAATGAGCACAGGATCCTTAGTGGCCGCCCCCCTCTTGGCTTTCTCAACCCAAGGCTCTACCAGCAGCATGGGGCAGGACTCTTTGATGTAACCCGTGGCTGCCATGAGTCCTGTCTGGATGAAGAGGTAGAGGGCCAGGGTTTCTGCTCTGGTCCTGGCTGGGATCCTGTAACAGGCTGGGGAACACCCAACTTCCCAGCTTTGCTGAAGACTCTACTCAACCCCTGA

Back to List