Details for gene: SYNE1


integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; nucleoplasm : That part of the nuclear content other than the chromosomes or the nucleolus. ; nuclear envelope : The double lipid bilayer enclosing the nucleus and separating its contents from the rest of the cytoplasm; includes the intermembrane space, a gap of width 20-40 nm (also called the perinuclear space). ; nuclear membrane : Either of the lipid bilayers that surround the nucleus and form the nuclear envelope; excludes the intermembrane space. ; actin binding : Interacting selectively and non-covalently with monomeric or multimeric forms of actin, including actin filaments. ; nuclear outer membrane : The outer, i.e. cytoplasm-facing, lipid bilayer of the nuclear envelope; continuous with the endoplasmic reticulum of the cell and sometimes studded with ribosomes. ; RNA binding : Interacting selectively and non-covalently with an RNA molecule or a portion thereof. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; Golgi apparatus : A membrane-bound cytoplasmic organelle of the endomembrane system that further processes the core oligosaccharides (e.g. N-glycans) added to proteins in the endoplasmic reticulum and packages them into membrane-bound vesicles. The Golgi apparatus operates at the intersection of the secretory, lysosomal, and endocytic pathways. ; cytoskeleton : Any of the various filamentous elements that form the internal framework of cells, and typically remain after treatment of the cells with mild detergent to remove membrane constituents and soluble components of the cytoplasm. The term embraces intermediate filaments, microfilaments, microtubules, the microtrabecular lattice, and other structures characterized by a polymeric filamentous nature and long-range order within the cell. The various elements of the cytoskeleton not only serve in the maintenance of cellular shape but also have roles in other cellular functions, including cellular movement, cell division, endocytosis, and movement of organelles. ; cell differentiation : The process in which relatively unspecialized cells, e.g. embryonic or regenerative cells, acquire specialized structural and/or functional features that characterize the cells, tissues, or organs of the mature organism or some other relatively stable phase of the organism's life history. Differentiation includes the processes involved in commitment of a cell to a specific fate and its subsequent development to the mature state. ; protein homodimerization activity : Interacting selectively and non-covalently with an identical protein to form a homodimer. ; postsynaptic membrane : A specialized area of membrane facing the presynaptic membrane on the tip of the nerve ending and separated from it by a minute cleft (the synaptic cleft). Neurotransmitters cross the synaptic cleft and transmit the signal to the postsynaptic membrane. ; nucleus organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of the nucleus. ; spermatogenesis : The developmental process by which male germ line stem cells self renew or give rise to successive cell types resulting in the development of a spermatozoa. ; sarcomere : The repeating unit of a myofibril in a muscle cell, composed of an array of overlapping thick and thin filaments between two adjacent Z discs. ; actin filament binding : Interacting selectively and non-covalently with an actin filament, also known as F-actin, a helical filamentous polymer of globular G-actin subunits. ; Golgi organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of the Golgi apparatus. ; enzyme binding : Interacting selectively and non-covalently with any enzyme. ; nucleolus : A small, dense body one or more of which are present in the nucleus of eukaryotic cells. It is rich in RNA and protein, is not bounded by a limiting membrane, and is not seen during mitosis. Its prime function is the transcription of the nucleolar DNA into 45S ribosomal-precursor RNA, the processing of this RNA into 5.8S, 18S, and 28S components of ribosomal RNA, and the association of these components with 5S RNA and proteins synthesized outside the nucleolus. This association results in the formation of ribonucleoprotein precursors; these pass into the cytoplasm and mature into the 40S and 60S subunits of the ribosome. ; lamin binding : Interacting selectively and non-covalently with lamin; any of a group of intermediate-filament proteins that form the fibrous matrix on the inner surface of the nuclear envelope. ; cytoskeleton-nuclear membrane anchor activity : The binding activity of a molecule that brings together a cytoskeletal protein or protein complex and a nuclear membrane lipid or membrane-associated protein, in order to maintain the localization of the cytoskeleton at a specific location of the nuclear membrane. ; nuclear matrix anchoring at nuclear membrane : The process in which the nuclear matrix, the dense fibrillar network lying on the inner side of the nuclear membrane, is directly or indirectly linked to the nuclear membrane. ; meiotic nuclear membrane microtubule tethering complex : A nuclear membrane protein complex which connects the nuclear outer and inner membranes together, and links links the nuclear lumen to cytoplasmic microtubules during meiosis. ; muscle cell differentiation : The process in which a relatively unspecialized cell acquires specialized features of a muscle cell. ; P-body : A focus in the cytoplasm where mRNAs may become inactivated by decapping or some other mechanism. Protein and RNA localized to these foci are involved in mRNA degradation, nonsense-mediated mRNA decay (NMD), translational repression, and RNA-mediated gene silencing. ; cytoskeletal protein binding : Interacting selectively and non-covalently with any protein component of any cytoskeleton (actin, microtubule, or intermediate filament cytoskeleton). ; centrosome : A structure comprised of a core structure (in most organisms, a pair of centrioles) and peripheral material from which a microtubule-based structure, such as a spindle apparatus, is organized. Centrosomes occur close to the nucleus during interphase in many eukaryotic cells, though in animal cells it changes continually during the cell-division cycle. ;


Symbol
SYNE1
Name
spectrin repeat containing nuclear envelope protein 1
Entrez ID
23345
Ensembl ID
ENSG00000131018    (more details)
KEGG ID
hsa:23345    (more details)
OMIM ID
608441
Uniprot ID
B4E3R1  
GO ID
hsa:23345    (more details)
Chromosome
16
Strand
-1
Start
88382959
End
88440757
miRNA Interactions
hsa-miR-30c-5p (RPM: 3890.0396) / hsa-miR-141-3p (RPM: 2843.5066) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-200a-3p (RPM: 157.5826) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-30b-5p (RPM: 1466.5144) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-335-3p (RPM: 837.9252) / hsa-miR-338-3p (RPM: 158.4942) / hsa-miR-125b-5p (RPM: 10044.3546) / hsa-miR-495-3p (RPM: 8.062) / hsa-miR-507 (RPM: 0.0104) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-let-7f-5p (RPM: 17066.6836) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-let-7c-5p (RPM: 4028.6728) / hsa-miR-125a-5p (RPM: 11539.4616) / hsa-miR-1301-3p (RPM: 47.2112) / hsa-miR-148b-3p (RPM: 970.7614) / hsa-miR-378a-5p (RPM: 22.027) / hsa-miR-199b-5p (RPM: 234.7942) / hsa-miR-9-5p (RPM: 3525.806) / hsa-miR-452-5p (RPM: 23.696) / hsa-let-7i-5p (RPM: 2025.2084) / hsa-miR-98-5p (RPM: 1660.0964) / hsa-let-7e-5p (RPM: 3790.2074) / hsa-let-7g-5p (RPM: 3559.4376) / hsa-miR-128-3p (RPM: 329.321) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-373-3p (RPM: 0.0958) / hsa-miR-513b-5p (RPM: 0.2552) / hsa-miR-136-5p (RPM: 38.7962) / hsa-miR-199a-5p (RPM: 174.3046) / hsa-miR-21-5p (RPM: 5494.851) / hsa-miR-22-3p (RPM: 26348.475) / hsa-miR-138-2-3p (RPM: 0.1862) / hsa-miR-181a-5p (RPM: 52364.6344) / hsa-miR-412-3p (RPM: 0.02) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-511-5p (RPM: 1.3606) / hsa-miR-27b-5p (RPM: 73.6964) / hsa-miR-346 (RPM: 2.6286) / hsa-miR-33a-5p (RPM: 5.9422) / hsa-miR-141-5p (RPM: 20.664) / hsa-miR-26b-3p (RPM: 23.5016) / hsa-miR-493-3p (RPM: 6.665) / hsa-miR-31-5p (RPM: 310.1326) / hsa-miR-3177-5p (RPM: 0.1208) / hsa-miR-382-5p (RPM: 9.8234) / hsa-miR-17-3p (RPM: 13.6088) / hsa-miR-330-3p (RPM: 21.3424) / hsa-miR-532-5p (RPM: 129.2058) / hsa-miR-629-5p (RPM: 7.1172) / hsa-miR-93-3p (RPM: 9.5402) / hsa-miR-29a-5p (RPM: 3.125) / hsa-miR-501-5p (RPM: 3.2752) / hsa-miR-489-3p (RPM: 1.765) / hsa-miR-624-3p (RPM: 0.1456) / hsa-miR-124-5p (RPM: 23.3116) / hsa-miR-888-3p (RPM: 0.0024) / hsa-miR-340-3p (RPM: 15.2654) / hsa-miR-191-5p (RPM: 12993.8088) /
Involved Diseases
Posterior capsule opacification (PCO) /
Involved Pathways
Lysosome /
Sequence
ATGGCAACCTCCAGAGGGGCCTCCCGGTGTCCTCGGGATATCGCCAATGTGATGCAGAGGCTGCAAGATGAGCAAGAGATAGTACAAAAACGAACTTTCACAAAATGGATCAACTCTCATCTGGCCAAGCGGAAACCTCCAATGGTGGTGGACGATCTTTTTGAAGACATGAAAGATGGTGTTAAACTGCTTGCCCTTCTGGAGGTCCTGTCTGGGCAGAAACTGCCTTGTGAACAAGGACGCCGGATGAAGCGAATCCATGCTGTGGCTAACATTGGCACGGCACTCAAGTTCCTCGAAGGAAGAAAGATTAAATTAGTCAACATTAACTCCACCGATATAGCTGATGGCCGACCCTCAATAGTTCTTGGATTGATGTGGACCATTATTCTATATTTCCAGATTGAAGAGTTGACCAGCAACCTGCCCCAGCTCCAGTCTTTGTCCAGCAGCGCATCCTCCGTGGACAGCATAGTTAGCTCTGAGACTCCCAGCCCACCAAGTAAACGGAAGGTGACCACCAAGATCCAAGGAAATGCTAAGAAGGCTTTATTAAAGTGGGTTCAGTACACAGCTGGCAAGCAGACTGGAATAGAAGTAAAAGATTTTGGGAAGAGTTGGAGAAGCGGGGTTGCCTTTCATTCAGTTATTCATGCCATTCGACCGGAATTGGTGGACTTGGAGACAGTGAAAGGCAGATCCAACCGAGAAAATTTGGAGGATGCTTTCACTATCGCCGAAACAGAACTGGGGATCCCAAGACTGCTAGATCCTGAAGACGTTGATGTGGATAAACCAGATGAGAAATCTATTATGACCTATGTAGCCCAGTTTCTGAAACATTATCCTGACATCCACAATGCAAGCACTGATGGGCAAGAGGATGATGAAATACTTCCAGGTTTCCCATCTTTTGCAAATTCTGTACAAAATTTTAAGAGAGAAGACAGAGTAATTTTTAAGGAAATGAAAGTTTGGATAGAACAATTTGAGAGAGATTTGACAAGAGCACAGATGGTGGAATCAAATTTACAGGATAAATATCAGTCATTTAAGCACTTCAGAGTTCAATATGAAATGAAGAGGAAACAGATTGAACATTTAATACAACCATTACACAGAGACGGTAAATTGTCACTTGACCAAGCATTGGTAAAACAATCTTGGGATAGAGTGACCTCCAGGCTCTTTGACTGGCATATACAGCTTGATAAATCTCTTCCTGCACCTCTGGGCACCATAGGTGCCTGGCTGTACAGAGCGGAGGTGGCCCTGAGAGAGGAAATAACCGTTCAACAGGTCCACGAGGAAACAGCAAACACGATACAACGGAAACTTGAGCAACATAAGGATCTGCTTCAAAACACGGATGCCCACAAAAGAGCATTCCATGAAATCTACCGGACCAGGTCTGTTAACGGGATTCCAGTGCCACCTGATCAATTAGAGGACATGGCCGAGAGGTTTCATTTTGTTTCCTCCACATCAGAGCTACACCTAATGAAAATGGAATTTTTAGAATTAAAGTACCGTCTGCTCTCACTGCTGGTTCTTGCAGAGTCAAAGCTGAAGTCTTGGATCATTAAGTACGGGAGGAGAGAGTCAGTGGAGCAGCTTCTACAAAACTACGTGTCTTTTATAGAAAATAGCAAGTTCTTTGAACAATATGAGGTGACATACCAGATCTTGAAACAGACAGCTGAGATGTATGTCAAAGCAGATGGTTCAGTGGAAGAAGCTGAGAATGTGATGAAATTCATGAATGAAACCACCGCTCAGTGGAGGAATCTCTCAGTAGAAGTGAGGAGTGTGAGGAGCATGCTGGAAGAAGTGATCTCTAACTGGGATCGCTATGGCAATACAGTGGCTAGTCTGCAAGCCTGGCTAGAGGATGCTGAAAAAATGCTCAATCAATCAGAAAATGCCAAAAAGGATTTTTTTCGAAATTTACCTCATTGGATTCAGCAGCATACTGCCATGAACGATGCTGGCAATTTTCTAATTGAAACCTGTGATGAGATGGTTTCCCGTGACCTGAAGCAGCAATTACTGTTGCTAAATGGGCGGTGGAGGGAGTTGTTTATGGAAGTCAAGCAATATGCTCAAGCTGATGAGATGGACAGAATGAAGAAGGAATACACAGACTGTGTTGTTACCCTGTCTGCTTTTGCAACGGAAGCCCATAAGAAACTTTCTGAACCCTTAGAAGTCTCTTTTATGAATGTCAAGCTATTAATTCAAGACTTGGAGGATATTGAGCAGAGGGTGCCTGTGATGGATGCCCAATACAAGATAATTACAAAGACAGCACACCTCATTACCAAAGAAAGCCCCCAAGAAGAAGGAAAAGAAATGTTTGCGACCATGTCAAAGCTCAAAGAGCAGCTAACCAAGGTCAAAGAATGTTACTCCCCACTCCTTTATGAGTCTCAGCAGCTGTTGATTCCGTTGGAGGAATTAGAAAAGCAGATGACGTCCTTTTATGACTCACTTGGGAAAATCAATGAAATTATCACAGTTCTTGAGCGTGAGGCACAATCGAGTGCCCTTTTTAAACAAAAACATCAGGAACTGTTAGCTTGTCAAGAAAACTGTAAGAAAACCTTGACACTTATTGAGAAAGGCAGTCAAAGTGTTCAAAAGTTTGTGACCTTGAGCAACGTGTTAAAGCATTTTGATCAGACGAGGCTACAAAGACAGATTGCAGATATTCATGTTGCTTTTCAGAGTATGGTAAAGAAAACTGGAGATTGGAAGAAGCATGTGGAAACCAACAGTCGCTTGATGAAGAAGTTTGAGGAGTCTCGAGCAGAGTTGGAGAAGGTACTGCGGATTGCTCAGGAGGGCCTGGAGGAAAAGGGGGATCCAGAGGAGCTCCTGCGGAGACACACTGAGTTTTTCAGTCAGCTGGATCAGAGGGTGCTCAATGCTTTCCTGAAAGCTTGTGATGAACTCACCGACATCCTTCCAGAGCAGGAGCAGCAGGGGCTGCAGGAAGCTGTTCGAAAGCTCCACAAACAATGGAAGGATCTTCAAGGAGAAGCCCCTTATCATTTGCTTCATCTGAAGATTGATGTGGAGAAGAATAGGTTCTTAGCCTCTGTAGAAGAATGCAGAACTGAGCTGGATCGAGAGACCAAGCTGATGCCCCAGGAAGGCAGTGAAAAGATAATTAAAGAGCACAGGGTTTTCTTCAGTGACAAAGGTCCTCATCATCTCTGTGAGAAAAGGTTACAGCTCATCGAGGAACTCTGTGTGAAACTCCCAGTGCGGGACCCAGTAAGGGACACACCTGGAACCTGTCACGTGACTCTCAAAGAGCTCAGAGCTGCCATTGACAGCACCTACAGGAAGCTCATGGAAGACCCAGACAAGTGGAAGGACTACACTAGCAGATTCTCTGAGTTCTCATCTTGGATATCTACAAATGAGACACAATTAAAGGGGATCAAGGGTGAGGCCATCGATACTGCCAACCACGGAGAGGTTAAACGTGCCGTTGAAGAGATCAGAAATGGTGTTACCAAAAGGGGTGAGACCCTCAGCTGGCTGAAATCCAGGCTGAAAGTTTTGACAGAAGTTTCTTCTGAGAATGAAGCCCAAAAGCAGGGAGATGAGCTGGCAAAATTATCCAGCTCTTTCAAGGCTCTTGTGACGCTGCTGTCAGAGGTTGAAAAGATGCTAAGCAATTTTGGGGACTGTGTCCAGTACAAAGAAATAGTCAAAAATTCTCTCGAAGAATTAATTTCTGGCTCTAAAGAAGTCCAGGAACAAGCTGAGAAGATCTTGGATACTGAAAATCTGTTTGAAGCACAGCAGTTACTTCTTCATCACCAGCAAAAGACAAAGCGGATCTCAGCAAAGAAGAGAGATGTGCAGCAGCAGATCGCGCAGGCGCAGCAGGGAGAAGGGGGGCTGCCTGACCGAGGCCACGAGGAGCTGCGGAAGCTGGAGAGCACACTGGATGGCCTGGAGCGCAGCCGGGAGAGGCAGGAACGCCGCATCCAGGTCACATTAAGAAAATGGGAGCGATTTGAAACAAACAAAGAAACAGTAGTAAGATACCTTTTTCAAACAGGTTCCAGTCATGAACGCTTCTTGAGTTTTAGCAGTTTGGAAAGTTTATCTTCAGAACTGGAACAAACAAAGGAGTTTTCTAAACGGACAGAAAGTATTGCAGTCCAGGCTGAGAACCTTGTAAAGGAAGCTTCAGAGATACCGCTTGGGCCCCAAAATAAGCAGCTGCTTCAACAGCAGGCCAAGTCAATCAAAGAACAAGTCAAAAAATTAGAAGACACGCTTGAAGAAGATATTAAAACCATGGAAATGGTGAAAACCAAGTGGGATCATTTTGGCAGTAATTTTGAGACTCTGTCCGTCTGGATAACTGAGAAAGAAAAAGAACTCAATGCCTTGGAAACTTCGTCATCTGCCATGGACATGCAAATCAGCCAAATTAAGGTCACAATTCAGGAAATAGAAAGTAAGCTCAGCAGCATTGTAGGATTAGAAGAAGAAGCCCAGTCTTTTGCTCAGTTTGTTACCACTGGAGAATCTGCTCGAATTAAAGCCAAGTTGACACAAATAAGAAGATACGGGGAAGAGCTTCGAGAGCATGCACAGTGTCTGGAAGGAACAATCCTGGGACATTTATCTCAGCAGCAAAAGTTTGAAGAGAACCTTAGAAAGATCCAGCAATCTGTGTCTGAATTTGAAGATAAACTTGCTGTTCCAATTAAAATATGTTCTTCAGCTACAGAAACATACAAAGTTCTTCAAGAACATATGGATCTCTGCCAGGCCCTGGAGTCACTGAGCAGCGCGATCACTGCCTTCTCAGCCAGTGCCAGGAAGGTTGTGAACAGAGATTCCTGTGTTCAGGAGGCTGCGGCTCTACAGCAGCAATACGAGGACATCCTAAGGAGGGCGAAGGAGAGACAGACGGCGCTGGAGAATCTGCTGGCCCACTGGCAGAGGCTAGAGAAAGAACTATCATCCTTTTTGACCTGGTTAGAGCGGGGTGAAGCTAAAGCCAGTTCCCCAGAAATGGACATTTCTGCAGACAGAGTCAAAGTGGAAGGTGAACTTCAGTTAATACAGGCACTGCAAAATGAAGTTGTATCCCAGGCCTCATTCTATAGCAAACTTTTGCAATTGAAGGAATCATTGTTCTCAGTAGCCTCCAAAGATGATGTGAAAATGATGAAACTACATTTGGAGCAGTTGGATGAGAGATGGAGAGATTTACCACAGATCATTAACAAAAGGATTAATTTTCTTCAGTCTGTGGTTGCTGAACACCAGCAATTTGATGAGCTGCTGCTTTCCTTTTCTGTCTGGATTAAACTGTTTCTCAGTGAATTACAAACTACCTCTGAGATTAGCATAATGGACCATCAAGTAGCCCTTACTCGGCATAAGGACCACGCAGCAGAAGTAGAGAGCAAAAAGGGCGAATTGCAGAGTCTGCAGGGTCACTTAGCAAAGTTGGGTTCTCTGGGCCGTGCTGAGGACCTCCACCTCCTGCAGGGAAAGGCTGAGGACTGCTTCCAGCTGTTTGAGGAGGCCAGCCAGGTTGTGGAGAGGCGGCAGCTTGCCCTGTCCCATTTGGCAGAATTCCTCCAGAGCCATGCCTCTCTGTCCGGCATTCTCCGCCAGCTGAGGCAAACAGTGGAAGCAACCAACAGTATGAATAAGAACGAGTCTGATTTGATAGAAAAGGACCTCAATGATGCTCTTCAAAATGCTAAAGCATTAGAATCTGCTGCCGTCAGTCTGGATGGCATTCTTTCCAAAGCCCAATACCATCTGAAAATCGGGAGCTCTGAGCAAAGGACTTCCTGCAGAGCCACGGCTGATCAGCTCTGTGGAGAGGTAGAGAGGATCCAGAACCTTCTGGGAACCAAGCAGAGTGAGGCAGATGCTCTGGCAGTGTTGAAAAAAGCATTCCAAGACCAGAAAGAGGAGCTTCTGAAAAGCATTGAGGACATTGAAGAAAGGACTGACAAAGAGCGATTGAAAGAACCTACCCGCCAAGCTCTTCAGCAGAGGTTAAGAGTGTTTAATCAGCTAGAAGATGAATTGAATTCTCACGAGCATGAACTATGTTGGTTGAAAGACAAAGCCAAGCAAATTGCCCAGAAAGATGTAGCTTTTGCACCTGAAGTTGACAGGGAGATAAACCGCTTAGAGGTCACCTGGGATGATACCAAAAGACTAATTCATGAAAATCAGGGTCAGTGCTGTGGACTTATTGACTTAATGAGAGAATATCAGAACCTGAAATCAGCTGTATCTAAAGTCTTAGAAAATGCCAGCAGTGTGATTGTAACCAGAACTACCATAAAAGATCAGGAGGATCTTAAATGGGCTTTTTCCAAGCATGAAACTGCCAAGAACAAAATGAATTACAAACAGAAAGACTTGGATAACTTTACCAGCAAAGGAAAACACTTGTTATCTGAGCTGAAGAAAATTCACAGTAGTGATTTCAGCTTGGTGAAAACAGACATGGAGAGCACCGTGGACAAATGGCTGGATGTATCAGAGAAACTTGAAGAAAACATGGATAGGCTGAGAGTAAGCCTGTCCATTTGGGATGATGTACTGTCAACTAGAGATGAGATTGAGGGATGGTCAAACAACTGCGTTCCACAGATGGCAGAAAACATCAGCAACCTGGATAACCACCTCAGAGCTGAAGAACTGCTTAAAGAATTTGAGTCTGAAGTTAAAAACAAAGCATTGAGATTGGAAGAACTGCATTCCAAAGTTAATGATCTGAAAGAATTAACTAAAAATCTAGAAACACCGCCAGACCTTCAGTTTATAGAAGCAGACTTAATGCAGAAACTGGAGCATGCCAAAGAAATAACTGAAGTAGCAAAAGGAACCCTGAAGGATTTCACGGCTCAAAGTACACAAGTGGAGAAGTTTATTAATGACATAACAACATGGTTCACAAAAGTGGAAGAATCGTTGATGAACTGTGCCCAAAATGAGACTTGTGAAGCATTGAAAAAAGTCAAGGATATACAAAAAGAACTTCAAAGTCAACAAAGCAACATCAGCTCTACCCAAGAAAATCTCAATAGCTTGTGCCGCAAGTACCACTCAGCTGAGTTGGAGAGCCTGGGCCGTGCAATGACTGGTCTGATAAAGAAACATGAAGCCGTGAGCCAGTTGTGCTCCAAAACCCAGGCCAGCCTGCAGGAATCTCTGGAAAAACACTTCAGTGAGTCTATGCAGGAATTCCAAGAATGGTTTTTGGGAGCAAAGGCAGCAGCAAAAGAATCATCAGATCGCACCGGTGACAGCAAAGTTCTAGAAGCAAAGCTCCATGATCTTCAGAACATTTTGGACTCAGTCAGTGATGGGCAGAGCAAACTTGATGCAGTGACTCAAGAAGGACAAACTTTGTATGCACATTTGTCTAAACAAATTGTCAGTAGCATTCAAGAACAAATCACAAAGGCCAATGAAGAGTTTCAAGCATTTCTGAAACAATGCCTTAAAGATAAGCAGGCTCTTCAAGACTGTGCTTCAGAACTTGGAAGCTTTGAAGATCAGCACAGAAAACTGAACTTATGGATCCATGAAATGGAAGAAAGGTTCAATACGGAAAACTTGGGAGAGAGTAAACAGCACATTCCTGAGAAGAAAAATGAAGTTCATAAAGTTGAAATGTTTTTGGGAGAACTGCTGGCTGCAAGAGAGTCTCTTGATAAGCTTTCCCAGAGAGGGCAGCTTCTGAGTGAAGAAGGCCACGGTGCTGGGCAGGAGGGCCGCCTGTGTTCCCAGCTCCTCACAAGCCACCAGAACCTACTTAGAATGACCAAAGAGAAACTCCGGAGCTGCCAGGTGGCCCTTCAGGAGCACGAAGCCCTGGAGGAAGCACTGCAAAGCATGTGGTTCTGGGTGAAGGCCATTCAGGACAGACTGGCCTGTGCAGAGAGCACTCTTGGGAGCAAAGACACCCTGGAGAAACGGCTGTCACAAATACAGGATATTCTCCTGATGAAAGGTGAAGGGGAAGTTAAGTTGAATATGGCCATTGGCAAGGGGGAACAGGCCTTGAGAAGTAGCAACAAAGAAGGTCAGAGGGTGATTCAGACTCAGTTAGAGACCCTTAAAGAAGTGTGGGCTGACATCATGAGCTCCTCCGTCCACGCTCAAAGCACTTTAGAGTCTGTGATTAGCCAATGGAATGACTATGTAGAGAGGAAAAACCAGTTGGAGCAGTGGATGGAATCAGTGGATCAAAAAATAGAACATCCCTTACAACCACAGCCAGGTCTGAAAGAGAAGTTCGTCCTGCTTGACCACCTCCAGTCCATCCTGTCTGAGGCAGAAGATCACACGAGAGCCCTTCACCGTCTAATTGCGAAGTCCAGGGAGCTCTACGAAAAGACAGAGGATGAGTCTTTCAAGGACACAGCTCAAGAGGAGCTGAAAACACAGTTTAATGATATAATGACTGTTGCCAAGGAAAAAATGAGGAAAGTGGAAGAGATTGTGAAAGATCATCTAATGTATTTAGATGCGGTCCACGAGTTCACAGATTGGCTCCATTCAGCAAAGGAAGAACTTCACCGGTGGTCAGATATGTCTGGAGATTCATCAGCCACCCAGAAAAAGTTATCAAAAATTAAGGAGCTGATAGATTCCAGAGAGATTGGTGCAAGCCGTCTCAGCAGAGTGGAGTCGCTGGCTCCCGAAGTGAAACAGAACACAACTGCCAGTGGGTGTGAGCTCATGCACACGGAGATGCAGGCCCTGCGTGCCGACTGGAAGCAGTGGGAAGACAGTGTATTCCAAACGCAGAGCTGTTTGGAGAACCTGGTCAGCCAGATGGCCCTTTCGGAGCAGGAATTCTCAGGCCAAGTGGCTCAACTGGAGCAGGCCCTGGAACAGTTCAGTGCCCTTCTGAAAACCTGGGCTCAGCAGTTAACCCTCCTGGAAGGCAAGAACACGGATGAGGAGATAGTGGAATGCTGGCACAAAGGACAAGAGATACTGGATGCTTTGCAAAAAGCAGAGCCTAGAACAGAGGATCTCAAGTCTCAGCTGAATGAACTTTGTCGATTTTCCAGAGACCTGAGTACCTACAGTGGAAAAGTTTCTGGCTTGATTAAAGAGTATAATTGTCTTTGTTTGCAAGCATCCAAGGGCTGCCAGAATAAAGAACAGATTTTACAGCAAAGATTTCGAAAGGCCTTCAGGGATTTCCAGCAGTGGTTGGTTAATGCAAAAATCACTACCGCCAAGTGTTTTGATATACCTCAAAATATAAGTGAAGTTTCAACTAGTCTTCAGAAAATACAGGAGTTTTTGTCAGAAAGTGAAAATGGACAGCACAAGCTAAACATGATGCTGTCTAAAGGGGAACTTCTGAGTACCCTGCTGACCAAAGAGAAAGCGAAAGGGATCCAGGCCAAAGTTACAGCTGCAAAAGAAGATTGGAAAAATTTTCATTCAAATCTCCACCAAAAAGAATCTGCTCTAGAGAATCTAAAGATCCAAATGAAGGACTTTGAAGTAAGTGCTGAGCCTATCCAGGACTGGCTGAGTAAAACTGAGAAGATGGTCCATGAAAGCAGCAATCGCCTCTATGATCTGCCAGCAAAGAGGAGGGAGCAGCAGAAGCTCCAGTCTGTCCTTGAGGAAATACACTGCTACGAGCCTCAGCTCAACAGGCTGAAAGAGAAAGCTCAGCAGCTGTGGGAAGGACAAGCTGCCAGCAAGAGCTTTAGGCACAGAGTGTCGCAGCTGTCTTCTCAGTATCTAGCGCTAAGCAATTTAACAAAGGAGAAAGTGTCAAGACTGGATAGAATCGTTGCAGAACACAATCAGTTCTCTCTTGGGATTAAAGAATTACAAGACTGGATGACGGATGCGATTCACATGCTGGATTCATACTGCCACCCGACATCCGACAAAAGTGTGCTGGACAGCAGGACGCTCAAGCTCGAGGCTCTATTATCAGTCAAACAGGAAAAAGAGATTCAGATGAAAATGATAGTGACCAGGGGAGAATCTGTCCTTCAGAATACTTCTCCAGAAGGCATTCCCACTATTCAGCAGCAGCTGCAGAGTGTGAAGGATATGTGGGCATCCCTTTTGTCTGCAGGGATTCGTTGTAAAAGCCAACTCGAAGGAGCTCTCTCCAAGTGGACAAGTTATCAGGATGGCGTTCGACAGTTCTCCGGTTGGATGGATAGTATGGAAGCCAACCTGAATGAATCAGAAAGGCAGCATGCGGAGCTGCGGGATAAAACAACGATGCTCGGAAAAGCCAAGTTATTAAATGAAGAAGTGCTGAGTTACAGCAGCTTGCTGGAGACCATCGAAGTCAAAGGGGCTGGCATGACAGAACACTATGTCACCCAGCTAGAACTCCAGGATCTACAGGAACGATACAGAGCCATCCAAGAGAGGGCCAAGGAAGCCGTAACCAAGTCTGAAAAACTTGTCCGCCTGCACCAAGAGTATCAGAGAGACCTAAAGGCATTTGAAGTTTGGTTGGGGCAAGAACAAGAAAAGCTCGACCAGTATTCAGTTCTTGAAGGTGATGCCCACACTCATGAGACAACATTGCGTGATCTTCAGGAGCTACAGGTACACTGTGCAGAGGGGCAGGCCCTGTTGAACTCAGTGCTGCACACCAGAGAGGATGTGATCCCATCAGGTATCCCACAGGCAGAGGACCGGGCTTTAGAGTCTCTCCGGCAAGACTGGCAGGCTTACCAGCACAGGCTGTCCGAGACTCGAACTCAGTTCAATAACGTGGTGAACAAATTGAGGCTAATGGAGCAAAAGTTTCAGCAAGTAGATGAATGGCTCAAAACAGCAGAGGAGAAAGTTAGTCCCAGGACCAGACGTCAGTCTAACAGGGCAACCAAGGAGATACAATTACATCAGATGAAGAAGTGGCACGAAGAAGTGACTGCATACAGAGATGAAGTTGAGGAAGTGGGAGCTAGAGCTCAGGAGATACTGGACGAGAGCCACGTGAACAGCAGAATGGGTTGCCAGGCCACCCAGCTGACTTCCAGATACCAGGCCCTGCTTCTCCAAGTGCTGGAACAAATAAAATTCCTGGAGGAGGAGATTCAGAGTTTGGAGGAATCAGAATCATCCCTCAGTTCCTATTCTGATTGGTATGGCTCTACTCATAAAAACTTCAAGAATGTGGCTACCAAGATTGACAAAGTAGATACAGTAATGATGGGGAAGAAATTGAAGACGTTGGAGGTTTTGCTCAAAGACATGGAGAAAGGTCACAGTTTGCTGAAATCAGCCCGGGAGAAAGGAGAGAGGGCTGTTAAATACTTGGAGGAAGGCGAGGCAGAGAGGTTAAGAAAGGAGATTCATGATCACATGGAGCAGTTGAAGGAACTGACCAGCACTGTCCGGAAAGAACACATGACGCTGGAAAAAGGTCTTCATTTAGCAAAGGAATTCTCAGATAAATGCAAAGCACTGACACAGTGGATAGCAGAATACCAGGAAATTCTACATGTTCCTGAAGAACCCAAAATGGAATTATATGAGAAAAAAGCTCAGTTATCTAAATACAAGTCACTTCAACAAACGGTGCTGTCCCATGAACCATCAGTAAAGTCAGTGAGAGAGAAGGGTGAAGCTCTTTTGGAACTGGTGCAGGACGTCACTTTAAAGGACAAAATAGATCAACTTCAAAGTGATTACCAGGACCTGTGCAGCATAGGAAAGGAGCATGTCTTCAGTCTGGAGGCGAAAGTCAAAGACCATGAAGACTACAACAGTGAGCTCCAAGAGGTCGAAAAGTGGCTGCTGCAGATGTCTGGCAGACTGGTGGCACCTGACCTCCTGGAGACAAGCAGCCTGGAGACAATCACCCAGCAATTGGCCCACCACAAGGCAATGATGGAAGAAATTGCTGGTTTTGAAGACCGTTTGAACAATCTTCAAATGAAAGGTGATACTTTGATTGGCCAATGTGCAGACCACCTGCAAGCGAAACTTAAACAAAACGTGCATGCTCATCTGCAGGGCACAAAGGACAGCTACTCAGCGATCTGCAGCACAGCTCAGAGGATGTACCAGAGTTTGGAACACGAACTTCAGAAGCACGTCAGCCGACAAGACACCCTGCAGCAGTGCCAGGCCTGGCTTTCTGCAGTCCAGCCGGATTTAGAGCCAAGTCCTCAACCACCTCTTAGTAGGGCAGAAGCCATTAAGCAGGTCAAACACTTCAGAGCTTTGCAAGAGCAGGCAAGGACCTACCTAGATCTCCTTTGCTCCATGTGTGACCTGTCAAATGCTTCGGTGAAAACCACAGCAAAAGACATTCAACAAACAGAGCAAACGATTGAACAAAAGCTTGTCCAGGCCCAGAACTTAACTCAGGGCTGGGAAGAGATCAAGCACCTGAAGTCTGAGCTCTGGATTTACCTGCAAGATGCTGATCAGCAACTGCAGAACATGAAGAGGAGGCACTCTGAGCTGGAGCTGAACATTGCACAGAACATGGTTTCACAAGTTAAGGATTTTGTTAAGAAACTACAGAGCAAACAGGCATCCGTGAACACCATAATAGAAAAGGTGAATAAGTTAACAAAGAAGGAGGAATCGCCTGAACACAAGGAAATAAATCATTTAAATGATCAGTGGCTCGATTTGTGCCGTCAGTCTAACAACCTGTGCTTGCAAAGGGAAGAGGATCTTCAGAGAACAAGAGATTACCATGACTGTATGAATGTTGTTGAAGTGTTCCTAGAAAAATTTACTACAGAATGGGATAACTTGGCCAGATCTGATGCAGAGAGTACAGCTGTCCACCTGGAAGCTTTGAAAAAGTTAGCATTGGCATTGCAGGAGAGAAAGTATGCTATTGAAGATCTGAAAGATCAAAAGCAGAAAATGATAGAGCATCTGAATTTAGATGACAAGGAGTTAGTCAAAGAACAGACGAGTCATTTAGAGCAACGTTGGTTTCAGCTTGAGGACCTCATTAAAAGGAAAATCCAAGTGTCAGTCACCAACTTGGAGGAGTTAAATGTGGTGCAGTCCAGATTTCAGGAGCTAATGGAGTGGGCAGAAGAGCAACAACCCAACATCGCCGAGGCCCTTAAGCAGAGCCCTCCTCCAGATATGGCTCAGAACCTTCTCATGGATCACCTGGCCATCTGCAGTGAACTGGAGGCCAAGCAGATGCTCCTGAAATCGCTTATAAAGGACGCAGACAGGGTCATGGCAGATCTTGGTCTCAATGAGCGACAGGTCATCCAGAAGGCTCTCTCTGATGCACAAAGCCACGTGAATTGTCTCAGTGACTTAGTGGGCCAGCGAAGAAAGTACTTAAACAAAGCCTTGTCCGAGAAAACCCAGTTTCTCATGGCAGTGTTCCAGGCCACCAGCCAAATTCAGCAACATGAGCGAAAGATAATGTTCCGTGAACACATCTGTCTGTTACCAGATGATGTGAGCAAACAAGTCAAAACATGTAAGAGTGCACAAGCCAGCCTCAAGACTTACCAAAATGAAGTCACTGGACTTTGGGCCCAGGGTCGCGAACTAATGAAGGAAGTCACAGAGCAGGAAAAGAGTGAAGTGCTGGGGAAGCTTCAGGAATTGCAGAGTGTCTATGACAGTGTTTTACAAAAGTGCAGTCACCGGTTACAAGAACTAGAGAAGAATTTGGTTTCTAGGAAGCATTTTAAGGAAGATTTTGATAAAGCTTGCCACTGGCTAAAACAAGCAGATATTGTTACATTTCCTGAAATCAACCTAATGAATGAGAGTTCTGAGCTTCATACACAACTGGCTAAATACCAAAACATTCTTGAACAATCTCCAGAATATGAAAATCTTCTACTTACGCTGCAGAGAACTGGGCAGACCATATTACCATCGCTGAATGAAGTCGATCATTCCTACCTCAGTGAAAAGCTAAATGCTTTGCCTCGACAATTTAATGTAATTGTTGCCTTGGCTAAAGACAAGTTCTATAAAGTCCAGGAAGCAATTCTTGCTCGGAAGGAATATGCTTCCTTGATTGAGTTGACAACCCAGTCTCTGAGTGAACTTGAAGCCCAATTCTTGAGGATGAGCAAAGTTCCCACCGACCTGGCCGTTGAGGAGGCTCTTTCTCTGCAAGATGGTTGCAGAGCCATTCTGGACGAGGTGGCGGGCCTTGGGGAGGCGGTGGATGAACTGAACCAGAAAAAAGAAGGTTTTCGCAGCACAGGTCAGCCTTGGCAGCCAGACAAGATGCTGCACCTTGTCACCTTATATCACAGGCTGAAGCGACAAACAGAACAGAGGGTTAGCTTATTAGAAGACACCACCAGTGCTTACCAAGAACACGAGAAGATGTGCCAACAGCTGGAGAGACAACTGAAGTCTGTAAAAGAGGAGCAGTCCAAAGTGAATGAGGAAACGCTGCCTGCAGAGGAGAAGCTCAAAATGTATCACTCCCTGGCAGGAAGTCTCCAGGACTCAGGGATTGTACTGAAACGAGTAACCATACATCTTGAAGATCTTGCCCCACACCTTGACCCCTTGGCTTATGAGAAAGCCAGGCATCAGATCCAGTCCTGGCAAGGGGAGTTAAAACTGTTGACTTCTGCCATTGGTGAGACGGTGACAGAATGTGAGAGCCGAATGGTGCAGAGTATAGACTTCCAGACTGAGATGAGTCGCTCCCTGGACTGGCTGAGGAGAGTGAAGGCAGAGCTCAGTGGGCCGGTGTACCTAGACCTCAACCTGCAGGACATCCAAGAGGAAATCAGAAAAATCCAAATTCATCAGGAAGAGGTCCAGTCCAGCTTGAGAATCATGAATGCGCTGAGTCACAAGGAAAAGGAGAAGTTCACAAAGGCCAAGGAGCTGATTTCTGCGGATTTAGAACACAGCCTCGCTGAGCTCTCAGAGCTGGATGGAGACATCCAGGAAGCCTTACGCACCAGACAGGCTACCTTGACTGAAATATATAGCCAGTGTCAAAGGTATTATCAGGTATTTCAAGCAGCCAATGACTGGCTTGAGGATGCCCAAGAATTGTTACAGCTGGCAGGCAATGGCCTAGACGTGGAGAGCGCAGAGGAAAATCTCAAAAGCCACATGGAATTTTTCAGTACAGAGGATCAGTTCCATAGTAACCTGGAGGAGCTCCACAGCCTGGTAGCCACCCTGGACCCACTCATCAAGCCAACCGGCAAAGAAGACCTAGAACAGAAAGTGGCTTCTCTGGAACTCAGGAGCCAGAGGATGAGCCGGGACTCTGGTGCCCAAGTGGATCTCTTGCAGAGATGCACAGCTCAATGGCACGATTACCAGAAAGCAAGGGAAGAGGTTATTGAATTGATGAATGATACAGAAAAGAAATTGTCTGAGTTTTCTTTGTTGAAGACTTCGTCTAGTCATGAAGCGGAAGAAAAATTGTCAGAACACAAGGCTTTAGTGTCAGTGGTTAACTCTTTCCATGAGAAAATTGTGGCCCTTGAGGAAAAAGCTTCACAACTGGAGAAAACCGGAAATGATGCCAGCAAAGCCACCCTGAGCAGGTCAATGACCACCGTCTGGCAGCGCTGGACACGCCTTCGAGCTGTGGCCCAGGACCAGGAGAAGATCCTGGAAGATGCAGTGGATGAGTGGACGGGCTTTAACAACAAGGTTAAAAAGGCCACTGAAATGATTGATCAGCTGCAAGATAAGTTACCTGGAAGTTCAGCAGAGAAAGCATCGAAAGCAGAGCTCTTAACTCTTCTTGAATACCACGACACGTTCGTTCTGGAGCTGGAGCAGCAGCAGTCGGCCTTGGGCATGCTGCGGCAGCAAACCCTGAGCATGCTCCAGGATGGAGCCGCCCCAACCCCTGGGGAAGAGCCTCCGCTCATGCAGGAAATCACCGCCATGCAAGATCGGTGCCTGAACATGCAGGAGAAAGTGAAGACTAATGGAAAGTTGGTGAAGCAAGAGCTGAAGGACCGAGAAATGGTGGAGACTCAGATCAATTCTGTGAAATGTTGGGTTCAGGAAACGAAAGAATATTTAGGGAATCCAACAATAGAAATAGATGCTCAACTTGAAGAACTTCAGATTCTCCTAACAGAAGCCACAAATCACCGACAGAACATTGAAAAAATGGCAGAAGAACAGAAGGAGAAGTACTTAGGTCTTTATACCATATTACCTTCTGAACTCTCCCTTCAGTTGGCTGAAGTGGCGTTAGATCTAAAGATCCGAGATCAGATCCAAGACAAAATAAAAGAAGTTGAGCAGAGCAAGGCCACGAGCCAGGAACTCAGCCGGCAAATTCAGAAGTTAGCTAAAGACCTCACAACTATTCTAACTAAGCTGAAAGCGAAGACAGATAATGTAGTTCAAGCTAAAACTGACCAAAAGGTGCTGGGAGAGGAATTAGATGGCTGTAATTCAAAGTTAATGGAATTAGATGCAGCAGTACAGAAATTCTTGGAACAGAATGGCCAACTGGGTAAGCCACTGGCCAAGAAGATAGGAAAACTGACTGAACTTCACCAGCAGACCATTAGACAAGCTGAGAATCGGCTCTCCAAGCTCAATCAGGCAGCATCACATTTAGAAGAATACAATGAAATGCTTGAATTAATTTTGAAGTGGATTGAAAAAGCTAAAGTCTTGGCTCATGGAACTATTGCATGGAATTCTGCAAGCCAGCTTCGGGAACAATATATTTTGCATCAGACCCTGCTAGAAGAATCCAAAGAAATTGACAGTGAGCTGGAAGCAATGACTGAGAAATTACAGTACCTCACTAGCGTGTACTGTACAGAAAAAATGTCTCAGCAAGTGGCAGAACTGGGACGGGAGACTGAGGAGTTGCGACAGATGATCAAAATTCGTTTGCAGAACCTCCAAGATGCAGCTAAGGATATGAAAAAATTTGAAGCAGAGTTGAAAAAGTTACAAGCTGCCTTGGAGCAAGCCCAGGCAACACTGACTTCTCCAGAAGTTGGACGTCTCAGTCTCAAGGAGCAGCTCTCTCATCGGCAGCATTTGTTGTCTGAGATGGAGTCACTGAAGCCGAAGGTGCAAGCAGTGCAGCTCTGCCAGAGTGCCCTCCGGATCCCCGAGGATGTGGTTGCCAGCTTACCTCTCTGTCATGCTGCTCTGCGGCTGCAGGAAGAGGCCAGCCGGCTGCAGCACACCGCCATCCAGCAGTGTAACATCATGCAGGAAGCTGTGGTACAATATGAACAATATGAGCAAGAAATGAAACATCTCCAGCAACTGATAGAAGGAGCTCACAGAGAGATTGAGGATAAACCTGTTGCCACCAGTAACATACAGGAGCTGCAGGCTCAGATTTCTCGGCATGAGGAGCTGGCGCAGAAAATTAAGGGCTACCAGGAGCAGATCGCTTCTTTGAATTCCAAGTGCAAGATGCTGACGATGAAAGCCAAGCACGCCACCATGCTGCTGACGGTGACCGAGGTCGAGGGGCTGGCGGAAGGGACAGAGGACCTGGATGGGGAGCTCCTCCCCACGCCTTCGGCCCACCCCTCTGTGGTCATGATGACTGCAGGTCGCTGTCACACTTTGCTGTCACCGGTCACTGAGGAGTCTGGGGAGGAGGGAACCAACAGTGAGATTTCCTCTCCACCTGCCTGTCGCTCCCCTTCACCTGTGGCTAATACAGATGCTTCTGTTAACCAGGACATTGCATATTACCAAGCCTTGTCTGCTGAGAGGTTGCAGACAGATGCTGCAAAAATTCACCCCAGCACATCCGCATCCCAGGAGTTCTATGAACCGGGATTGGAGCCATCCGCTACTGCCAAACTGGGTGATTTGCAGCGTTCTTGGGAAACCTTAAAGAATGTGATCAGTGAGAAGCAGCGCACACTCTATGAAGCTTTGGAACGCCAGCAGAAGTACCAGGACTCCCTCCAGTCCATCTCTACGAAGATGGAGGCCATTGAGCTGAAACTCAGTGAGAGCCCAGAGCCTGGCAGGAGTCCAGAAAGCCAGATGGCTGAACATCAGGCATTGATGGATGAGATTCTCATGCTCCAGGATGAAATCAATGAGCTCCAGTCCTCTCTCGCAGAGGAGCTGGTATCCGAGTCTTGTGAGGCCGACCCTGCGGAGCAGCTGGCCTTGCAGTCCACGCTCACTGTCTTAGCCGAGCGAATGTCCACCATCAGGATGAAAGCCTCGGGGAAACGGCAGCTTTTGGAGGAGAAGTTGAATGATCAGCTGGAGGAACAAAGGCAGGAACAGGCCCTGCAGAGGTATCGCTGTGAAGCCGATGAGCTGGACAGCTGGCTCTTGAGTACCAAGGCCACTCTGGACACTGCGCTGAGTCCACCCAAGGAGCCCATGGACATGGAGGCCCAGCTTATGGACTGCCAGAATATGCTGGTGGAAATAGAGCAGAAGGTGGTGGCTTTATCAGAACTGTCAGTCCACAATGAGAACCTGCTGCTGGAGGGCAAAGCTCACACCAAGGACGAGGCCGAGCAGCTGGCTGGAAAGCTGAGAAGGCTCAAGGGGAGCCTGCTGGAGCTGCAGAGAGCCCTGCATGATAAGCAGCTCAACATGCAGGGAACAGCACAGGAGAAGGAGGAGAGCGATGTTGACCTAACAGCCACGCAGAGCCCCGGCGTCCAGGAATGGCTGGCCCAAGCTCGCACCACATGGACCCAGCAGCGGCAGAGCAGTCTCCAGCAACAAAAAGAGTTAGAACAGGAATTAGCCGAGCAGAAGAGTCTCCTTCGCTCAGTAGCCAGTCGTGGAGAGGAGATTCTAATTCAACATTCGGCGGCAGAGACCTCTGGTGATGCTGGCGAAAAACCTGATGTGTTATCCCAGGAGTTGGGGATGGAAGGGGAGAAATCATCCGCTGAAGACCAGATGAGAATGAAATGGGAAAGCCTACATCAAGAATTTAGTACCAAGCAGAAACTACTACAGAATGTTCTGGAACAGGAACAAGAGCAAGTGCTTTATAGCAGGCCAAATCGACTCTTGTCTGGTGTGCCACTGTACAAAGGGGACGTGCCAACCCAAGATAAATCTGCAGTTACATCTTTGCTGGATGGACTGAACCAAGCCTTCGAGGAGGTTTCATCCCAGAGTGGAGGGGCAAAGAGGCAGAGTATACACTTGGAGCAGAAGTTGTATGATGGAGTCTCAGCCACCTCTACTTGGTTGGATGACGTTGAAGAACGTTTATTTGTTGCCACAGCACTTTTACCAGAAGAAACAGAGACTTGTCTCTTCAACCAAGAGATTCTTGCCAAAGACATTAAGGAAATGTCTGAAGAAATGGATAAGAACAAAAACTTGTTTTCCCAAGCTTTTCCAGAGAATGGTGATAATCGAGATGTTATTGAAGATACTTTGGGTTGTCTTTTGGGCAGGTTATCCTTGCTAGACTCAGTAGTGAATCAACGATGTCATCAGATGAAAGAAAGACTTCAGCAAATACTAAATTTCCAGAATGATCTGAAAGTGCTGTTTACATCACTGGCTGACAACAAATACATCATTCTGCAAAAACTGGCAAATGTGTTTGAACAGCCCGTAGCAGAACAAATAGAGGCAATACAACAGGCTGAAGATGGACTCAAAGAATTTGATGCAGGAATCATTGAATTAAAGAGGCGTGGTGACAAGCTACAGGTCGAGCAGCCGTCCATGCAAGAACTCTCCAAGCTCCAGGACATGTATGATGAGCTGATGATGATCATTGGCTCCCGGAGGAGTGGTCTGAATCAGAACCTTACACTCAAGAGTCAGTATGAGAGGGCCCTACAAGATCTGGCTGACCTGCTAGAAACTGGTCAGGAGAAGATGGCAGGAGACCAGAAAATCATCGTGTCTTCCAAAGAGGAAATCCAGCAACTACTTGACAAACATAAGGAATACTTTCAGGGCCTGGAATCTCATATGATCTTGACTGAAACACTCTTCAGAAAGATAATCAGCTTTGCAGTCCAAAAGGAAACCCAGTTCCATACAGAGCTGATGGCTCAGGCTTCTGCTGTACTGAAACGGGCTCACAAGAGGGGTGTGGAGCTGGAGTACATTCTAGAGACGTGGTCCCATCTGGATGAGGACCAGCAGGAGCTCAGCAGACAGCTGGAGGTGGTGGAAAGCAGCATCCCAAGCGTGGGTCTGGTGGAGGAGAACGAGGACAGGCTTATTGACCGCATAACACTCTACCAGCATTTAAAATCTAGCCTTAATGAATACCAGCCCAAATTATATCAAGTATTAGATGATGGGAAACGACTTCTGATATCCATCAGCTGCTCAGATCTAGAAAGCCAACTAAATCAACTTGGAGAGTGCTGGCTAAGTAACACCAATAAAATGTCTAAGGAACTTCACAGACTGGAAACAATATTGAAACACTGGACCAGATATCAAAGTGAATCTGCAGATCTAATTCACTGGTTACAATCTGCAAAAGACCGGCTAGAATTTTGGACTCAGCAATCTGTGACAGTCCCACAAGAGCTGGAAATGGTCCGTGATCATCTAAATGCTTTCCTGGAGTTTTCTAAAGAAGTGGATGCCCAATCTTCCCTGAAATCATCTGTTCTGAGTACTGGAAATCAGCTCCTTCGACTAAAAAAGGTGGACACAGCCACGCTGCGCTCTGAGCTGTCGCGCATTGATAGCCAGTGGACTGACCTGCTAACCAATATCCCAGCCGTCCAGGAGAAGCTCCACCAGCTCCAGATGGATAAACTGCCTTCCCGCCATGCCATTTCTGAAGTCATGAGTTGGATTTCTCTAATGGAAAATGTTATTCAGAAGGATGAAGATAATATTAAAAATTCCATAGGTTACAAGGCAATTCATGAATACCTTCAGAAATATAAGGGTTTTAAGATAGACATTAACTGTAAACAGCTGACAGTGGATTTTGTGAACCAGTCCGTGCTACAAATCAGCAGTCAGGATGTGGAAAGTAAGCGTAGTGATAAGACTGATTTTGCTGAGCAACTTGGAGCAATGAATAAAAGTTGGCAAATTCTGCAAGGTCTAGTAACTGAGAAGATCCAGCTGTTGGAAGGCTTATTGGAATCTTGGTCAGAATATGAAAATAATGTACAATGTCTGAAAACATGGTTTGAAACCCAGGAAAAGAGACTAAAACAACAGCATCGAATTGGAGATCAGGCTTCTGTTCAAAATGCACTGAAAGACTGTCAGGATCTGGAAGATTTGATTAAAGCAAAAGAAAAAGAAGTAGAGAAAATTGAGCAGAATGGACTTGCTTTGATTCAGAACAAGAAAGAAGACGTCTCTAGCATTGTCATGAGCACACTGCGAGAGCTCGGCCAAACCTGGGCAAATTTAGATCACATGGTTGGACAATTAAAGATACTGCTGAAATCAGTGCTTGACCAATGGAGTAGTCACAAAGTGGCCTTTGACAAGATAAACAGTTACCTCATGGAGGCCAGATACTCTCTTTCCCGATTCCGTCTGCTGACTGGCTCCTTAGAAGCTGTGCAAGTTCAGGTGGACAATCTTCAGAATCTCCAAGATGATCTGGAAAAACAGGAAAGGAGCTTACAGAAATTTGGCTCTATCACCAACCAATTATTAAAAGAGTGTCACCCACCCGTGACAGAAACTCTTACCAATACACTGAAAGAAGTCAACATGAGATGGAATAACTTGCTGGAAGAGATTGCTGAGCAGCTACAGTCCAGCAAGGCCCTACTTCAGCTTTGGCAAAGATACAAGGACTACTCCAAACAGTGTGCTTCGACAGTTCAGCAGCAGGAGGATCGAACCAATGAGCTGTTGAAGGCAGCCACAAACAAGGACATTGCCGATGATGAGGTTGCCACATGGATTCAAGATTGCAACGACCTCCTCAAAGGACTGGGCACAGTTAAAGATTCCCTCTTTTTTCTCCATGAGCTGGGAGAGCAACTGAAGCAACAAGTGGATGCTTCCGCAGCATCAGCTATTCAATCGGATCAACTCTCTTTGAGTCAACACTTGTGTGCCCTGGAGCAAGCTCTCTGCAAACAGCAGACTTCATTACAGGCTGGAGTTCTTGATTATGAAACCTTTGCCAAGAGTTTAGAAGCTTTGGAGGCCTGGATAGTGGAAGCTGAAGAAATACTACAAGGGCAGGACCCTAGCCACTCATCTGACCTCTCCACAATCCAGGAAAGGATGGAAGAACTTAAGGGACAGATGTTAAAATTCAGCAGCATGGCTCCAGATTTAGACCGTCTAAATGAGCTTGGATATAGGTTACCCTTGAATGATAAGGAAATCAAAAGAATGCAGAATCTGAACCGCCATTGGTCTCTGATCTCCTCTCAGACTACAGAAAGATTCAGCAAGTTGCAGTCATTTTTGCTACAACATCAGACTTTCTTGGAAAAATGTGAAACATGGATGGAATTCCTAGTTCAGACAGAACAAAAGTTAGCAGTAGAGATTTCAGGAAATTATCAGCACCTTTTGGAACAGCAGAGAGCACACGAGTTGTTTCAAGCCGAGATGTTCAGTCGTCAGCAGATTTTGCACTCAATCATTATTGATGGGCAACGTCTTCTAGAACAAGGTCAAGTTGATGACAGGGATGAATTCAACCTGAAATTGACACTCCTCAGTAATCAATGGCAGGGAGTGATTCGCAGGGCCCAGCAGAGGCGGGGGATCATTGACAGCCAGATTCGCCAGTGGCAGCGCTATAGGGAGATGGCAGAAAAGCTTCGTAAATGGTTGGTTGAAGTGTCCTACCTCCCCATGAGTGGTCTCGGAAGTGTTCCTATACCACTGCAACAAGCAAGGACCCTCTTTGATGAAGTGCAGTTCAAAGAAAAAGTGTTTCTGCGGCAACAAGGCAGCTACATCCTGACTGTGGAGGCTGGCAAGCAACTCCTTCTCTCGGCGGACAGTGGCGCTGAGGCCGCCTTGCAGGCCGAACTCGCTGAAATCCAAGAGAAATGGAAATCAGCCAGCATGCGGCTGGAAGAACAGAAGAAAAAACTAGCCTTCTTGTTGAAAGACTGGGAAAAATGTGAGAAAGGAATAGCAGATTCCCTGGAGAAACTACGAACTTTCAAAAAGAAGCTTTCGCAGTCTCTCCCGGATCACCATGAAGAGCTCCATGCAGAACAAATGCGTTGCAAGGAATTAGAAAATGCAGTTGGGAGCTGGACAGATGACTTGACCCAGTTGAGCCTGCTGAAGGACACCCTCTCTGCCTATATCAGTGCTGATGATATCTCCATTCTTAATGAACGCGTAGAGCTTCTGCAAAGGCAGTGGGAAGAACTATGCCACCAGCTCTCCTTAAGGCGGCAGCAAATAGGTGAAAGATTGAATGAATGGGCAGTCTTCAGTGAAAAGAACAAGGAACTCTGTGAGTGGTTGACTCAAATGGAAAGCAAAGTTTCTCAGAATGGAGACATTCTCATTGAAGAAATGATAGAGAAGCTCAAGAAGGATTATCAAGAGGAAATTGCTATTGCTCAAGAGAACAAAATACAGCTCCAACAAATGGGAGAACGACTTGCTAAAGCCAGCCATGAAAGCAAAGCATCTGAGATTGAATACAAGCTGGGAAAGGTCAACGACCGGTGGCAGCATCTCCTGGACCTCATTGCAGCCAGGGTGAAGAAGCTGAAGGAGACCCTGGTAGCCGTGCAGCAGCTTGATAAGAACATGAGCAGCCTGAGGACCTGGCTCGCTCACATCGAGTCAGAGCTGGCCAAGCCAATAGTCTACGATTCCTGTAACTCGGAAGAAATACAGAGAAAGCTTAATGAGCAGCAGGAGCTTCAGAGAGACATAGAGAAGCACAGTACAGGTGTTGCATCTGTCCTCAACCTGTGTGAAGTCCTGCTGCACGACTGTGACGCCTGTGCCACTGATGCCGAGTGTGACTCTATACAGCAGGCTACGAGAAACCTGGACCGGCGGTGGAGAAACATTTGTGCTATGTCCATGGAAAGGAGGCTGAAAATCGAAGAGACGTGGCGATTGTGGCAGAAATTTCTGGATGACTATTCACGTTTTGAAGATTGGCTGAAGTCTTCAGAAAGGACAGCTGCTTTTCCCAGCTCTTCTGGGGTGATCTATACAGTTGCCAAGGAAGAACTAAAGAAATTTGAGGCTTTCCAGCGACAGGTCCACGAGTGCCTGACGCAGCTGGAACTGATCAACAAGCAGTACCGCCGCCTGGCCAGGGAGAACCGCACTGATTCAGCATGTAGCCTCAAACAGATGGTTCACGAAGGCAACCAGAGATGGGACAACCTGCAAAAGCGTGTCACCTCCATCTTGCGCAGACTCAAGCATTTTATTGGCCAGCGTGAGGAGTTTGAGACTGCGCGGGACAGCATTCTGGTCTGGCTCACAGAGATGGATCTGCAGCTCACTAATATTGAACATTTTTCTGAGTGTGATGTTCAAGCTAAAATAAAGCAACTCAAGGCCTTCCAGCAGGAAATTTCACTGAACCACAATAAGATTGAGCAGATAATTGCCCAAGGAGAACAGCTGATAGAAAAGAGTGAGCCCTTGGATGCAGCGATCATCGAGGAGGAACTAGATGAGCTCCGACGGTACTGCCAGGAGGTCTTCGGGCGTGTGGAAAGATACCATAAGAAACTGATCCGCCTGCCTCTCCCAGACGATGAGCACGACCTCTCAGACAGGGAGCTGGAGCTGGAAGACTCTGCAGCTCTGTCGGACCTGCACTGGCACGACCGCTCTGCAGACAGCCTGCTTTCTCCACAGCCTTCCTCCAATCTCTCCCTCTCGCTCGCTCAGCCCCTCCGGAGCGAGCGGTCAGGACGAGACACCCCGGCTAGTGTGGACTCCATCCCCCTGGAGTGGGATCACGACTATGACCTCAGTCGGGACCTGGAGTCTGCAATGTCCAGAGCTCTGCCCTCTGAGGATGAAGAAGGTCAGGATGACAAAGATTTCTACCTCCGGGGAGCTGTTGGCTTATCAGGGGACCACAGTGCCCTAGAGTCACAGATCCGACAACTGGGCAAAGCCCTGGATGATAGCCGTTTTCAGATACAGCAAACCGAAAATATCATTCGCAGCAAAACTCCCACGGGGCCGGAGCTAGACACCAGCTACAAAGGCTACATGAAACTGCTGGGCGAATGCAGTAGCAGTATAGACTCCGTGAAGAGACTGGAGCACAAACTGAAGGAGGAAGAGGAGAGCCTTCCTGGCTTTGTTAACCTGCATAGTACCGAAACCCAAACGGCTGGTGTGATTGACCGATGGGAGCTTCTCCAGGCCCAGGCATTGAGCAAGGAGTTGAGGATGAAGCAGAACCTCCAGAAGTGGCAGCAGTTTAACTCAGACTTGAACAGCATCTGGGCCTGGCTGGGGGACACGGAGGAGGAGTTGGAACAGCTCCAGCGTCTGGAACTCAGCACTGACATCCAGACCATCGAGCTCCAGATCAAAAAGCTCAAGGAGCTCCAGAAAGCTGTGGACCACCGCAAAGCCATCATCCTCTCCATCAATCTCTGCAGCCCTGAGTTCACCCAGGCTGACAGCAAGGAGAGCCGGGACCTGCAGGATCGCTTGTCGCAGATGAATGGGCGCTGGGACCGAGTGTGCTCTCTGCTGGAGGAGTGGCGGGGCCTGCTGCAGGATGCCCTGATGCAGTGCCAGGGTTTCCATGAAATGAGCCATGGTTTGCTTCTTATGCTGGAGAACATTGACAGAAGGAAAAATGAAATTGTCCCTATTGATTCTAACCTTGATGCAGAGATACTTCAGGACCATCACAAACAGCTTATGCAAATAAAGCATGAGCTGTTGGAATCCCAACTCAGAGTAGCCTCTTTGCAAGACATGTCTTGCCAACTACTGGTGAATGCTGAAGGAACAGACTGTTTAGAAGCCAAAGAAAAAGTCCATGTTATTGGAAATCGGCTCAAACTTCTCTTGAAGGAGGTCAGTCGTCATATCAAGGAACTGGAGAAGTTATTAGACGTGTCAAGTAGTCAGCAGGATTTGTCTTCCTGGTCTTCTGCTGATGAACTGGACACCTCAGGGTCTGTGAGTCCCACATCAGGAAGGAGCACCCCAAACAGACAGAAAACGCCACGAGGCAAGTGTAGTCTCTCACAGCCTGGACCCTCTGTCAGCAGTCCACATAGCAGGTCCACAAAAGGTGGCTCCGATTCCTCCCTTTCTGAGCCAGGGCCAGGTCGGTCCGGCCGCGGCTTCCTGTTCAGAGTCCTCCGAGCAGCTCTTCCCCTTCAGCTTCTCCTGCTCCTCCTCATCGGGCTTGCCTGCCTTGTACCAATGTCAGAGGAAGACTACAGCTGTGCCCTCTCCAACAACTTTGCCCGGTCATTCCACCCCATGCTCAGATACACGAATGGCCCTCCTCCACTCTGA

Back to List