Details for gene: ANO10


membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; intracellular membrane-bounded organelle : Organized structure of distinctive morphology and function, bounded by a single or double lipid bilayer membrane and occurring within the cell. Includes the nucleus, mitochondria, plastids, vacuoles, and vesicles. Excludes the plasma membrane. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; cation transmembrane transport : The process in which a cation is transported across a membrane. ; chloride transport : The directed movement of chloride into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; cation transport : The directed movement of cations, atoms or small molecules with a net positive charge, into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; intracellular calcium activated chloride channel activity : Enables the transmembrane transfer of chloride by a channel that opens in response to stimulus by a calcium ion or ions. Transport by a channel involves catalysis of facilitated diffusion of a solute (by an energy-independent process) involving passage through a transmembrane aqueous pore or channel, without evidence for a carrier-mediated mechanism. ; ion transmembrane transport : A process in which an ion is transported across a membrane. ; transmembrane transport : The process in which a solute is transported across a lipid bilayer, from one side of a membrane to the other. ; calcium activated cation channel activity : Enables the calcium concentration-regulatable energy-independent passage of cations across a lipid bilayer down a concentration gradient. ;


Symbol
ANO10
Name
anoctamin 10
Entrez ID
55129
Ensembl ID
ENSG00000160746    (more details)
KEGG ID
hsa:55129    (more details)
OMIM ID
613726
Uniprot ID
Q9NW15  
GO ID
hsa:55129    (more details)
Chromosome
3
Strand
-1
Start
43354859
End
43691594
miRNA Interactions
hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-2110 (RPM: 10.1142) / hsa-miR-92a-3p (RPM: 16961.15) / hsa-miR-92b-3p (RPM: 8345.0264) / hsa-miR-32-5p (RPM: 14.5562) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-3157-5p (RPM: 0.3264) / hsa-miR-766-3p (RPM: 5.2956) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-4482-5p (RPM: 0.0118) / hsa-miR-3176 (RPM: 2.1682) / hsa-miR-210-3p (RPM: 361.0562) /
Involved Diseases
Posterior capsule opacification (PCO) /
Involved Pathways
Sequence
ATGAAAGTGACCTTATCAGCTTTGGATACTTCTGAGAGTTCTTTCACACCTTTGGTGGTCATAGAACTTGCTCAGGATGTCAAAGAAGAAACCAAAGAATGGCTGAAAAACAGAATTATAGCTAAAAAAAAAGATGGAGGTGCCCAGTTGTTGTTTAGACCATTGTTAAATAAATATGAACAAGAAACACTAGAAAATCAGAACTTATATCTTGTTGGTGCCTCCAAGATTAGAATGTTACTAGGGGCAGAAGCAGTGGGATTGGTAAAAGAGTGCAATGATAACACCATGAGAGCCTTCACATACAGAACCAGACAGAACTTCAAAGGTTTTGATGATAACAATGATGATTTCCTGACAATGGCAGAATGTCAATTCATTATCAAACATGAACTTGAAAATCTTAGAGCTAAAGATGAAAAAATGATCCCTGGTTACCCTCAGGCAAAGTTGTATCCAGGAAAATCATTGTTGAGAAGATTGCTCACGTCTGGCATCGTGATTCAGGTGTTTCCACTGCATGACAGTGAAGCCCTGAAGAAGCTTGAGGACACCTGGTACACTCGGTTTGCTTTGAAGTATCAGCCCATAGACAGTATTCGTGGCTACTTTGGGGAAACAATTGCTCTGTACTTTGGATTTTTGGAGTATTTCACTTTTGCATTAATCCCCATGGCTGTCATTGGGTTACCTTACTACTTGTTTGTGTGGGAAGACTATGACAAGTACGTGATCTTTGCCTCGTTCAACCTCATCTGGTCCACGGTGATTCTGGAACTGTGGAAGCGTGGCTGTGCCAACATGACCTACAGGTGGGGGACACTGCTCATGAAGAGAAAGTTTGAGGAGCCCCGGCCAGGATTTCATGGTGTCTTGGGTATCAATTCCATCACTGGGAAGGAGGAGCCTCTGTACCCCAGCTACAAGAGACAGTTGCGCATTTACCTGGTCTCCCTGCCATTCGTGTGCCTCTGCCTCTATTTCTCACTGTATGTCATGATGATTTACTTCGACATGGAGGTTTGGGCCTTGGGTCTACATGAGAACAGCGGGTCTGAGTGGACCAGTGTCCTGTTGTATGTGCCCAGCATCATCTATGCCATTGTGATTGAGATCATGAATCGTCTCTATCGATATGCTGCCGAGTTTTTAACTTCATGGGAGAATCACAGATTGGAATCTGCCTATCAGAACCATCTAATTCTGAAAGTTTTAGTGTTCAACTTCCTCAATTGCTTTGCCTCACTCTTCTATATTGCCTTTGTCTTGAAAGATATGAAGCTTTTGCGCCAGAGCTTGGCCACTCTCCTAATTACCTCCCAGATCCTCAACCAAATTATGGAATCTTTTCTTCCTTATTGGCTCCAAAGGAAGCATGGTGTGCGGGTGAAGAGGAAGGTGCAGGCTTTAAAGGCAGACATTGATGCTACATTATATGAACAAGTCATCCTGGAAAAAGAAATGGGAACTTATTTGGGCACCTTTGATGATTACTTGGAGTTATTCCTGCAGTTTGGTTATGTGAGCCTTTTCTCCTGTGTTTACCCATTAGCAGCTGCCTTTGCTGTGTTAAATAACTTCACTGAAGTAAATTCAGATGCCTTAAAAATGTGCAGGGTCTTCAAACGTCCATTCTCAGAACCTTCAGCCAATATTGGTGTGTGGCAGATCATATTTTGTTTGGACACAGGTGTAAAGAGAGGGCTGAATTGCAAGGTCATGAGGAATCTTTTGGGGGAAATGGAAATGTCCTGTGTCTTGTTTGTGGTGGTGGTGGTTTCACAGTTGGCTTTTGAAACGATGAGTGTTATATCTGTGGTCACTAACTGTGCGCTGATTGGAATGTCACCACAAGTGAATGCAGTCTTTCCAGAATCAAAAGCAGACCTCATTTTGATTGTAGTAGCAGTGGAGCAAATGAAGCTCGTGACCGAGAACCTGAAGGAGGAACCAATGGAAAGCGGGAAGGAGAAGGCAACCTGA

Back to List