Details for gene: GRM1


G protein-coupled receptor signaling pathway : A series of molecular signals that proceeds with an activated receptor promoting the exchange of GDP for GTP on the alpha-subunit of an associated heterotrimeric G-protein complex. The GTP-bound activated alpha-G-protein then dissociates from the beta- and gamma-subunits to further transmit the signal within the cell. The pathway begins with receptor-ligand interaction, or for basal GPCR signaling the pathway begins with the receptor activating its G protein in the absence of an agonist, and ends with regulation of a downstream cellular process, e.g. transcription. The pathway can start from the plasma membrane, Golgi or nuclear membrane. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; G protein-coupled receptor activity : Combining with an extracellular signal and transmitting the signal across the membrane by activating an associated G-protein; promotes the exchange of GDP for GTP on the alpha subunit of a heterotrimeric G-protein complex. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; signal transduction : The cellular process in which a signal is conveyed to trigger a change in the activity or state of a cell. Signal transduction begins with reception of a signal (e.g. a ligand binding to a receptor or receptor activation by a stimulus such as light), or for signal transduction in the absence of ligand, signal-withdrawal or the activity of a constitutively active receptor. Signal transduction ends with regulation of a downstream cellular process, e.g. regulation of transcription or regulation of a metabolic process. Signal transduction covers signaling from receptors located on the surface of the cell and signaling via molecules located within the cell. For signaling between cells, signal transduction is restricted to events at and within the receiving cell. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; integral component of plasma membrane : The component of the plasma membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; glutamate receptor activity : Combining with glutamate and transmitting the signal from one side of the membrane to the other to initiate a change in cell activity. ; regulation of postsynaptic membrane potential : Any process that modulates the potential difference across a post-synaptic membrane. ; adenylate cyclase-inhibiting G protein-coupled glutamate receptor signaling pathway : The series of molecular signals generated as a consequence of a G protein-coupled glutamate receptor binding to its physiological ligand, where the pathway proceeds with inhibition of adenylyl cyclase and a subsequent decrease in the concentration of cyclic AMP (cAMP). ; G protein-coupled glutamate receptor signaling pathway : A series of molecular signals initiated by glutamate binding to a glutamate receptor on the surface of the target cell, and proceeding with the activated receptor promoting the exchange of GDP for GTP on the alpha-subunit of an associated heterotrimeric G-protein complex. Ends with regulation of a downstream cellular process, e.g. transcription. ; adenylate cyclase inhibiting G protein-coupled glutamate receptor activity : Combining with glutamate and transmitting the signal across the membrane by activating the alpha-subunit of an associated heterotrimeric G-protein complex to inhibit downstream adenylate cyclase activity. ; regulation of synaptic transmission, glutamatergic : Any process that modulates the frequency, rate or extent of glutamatergic synaptic transmission, the process of communication from a neuron to another neuron across a synapse using the neurotransmitter glutamate. ; chemical synaptic transmission : The vesicular release of classical neurotransmitter molecules from a presynapse, across a chemical synapse, the subsequent activation of neurotransmitter receptors at the postsynapse of a target cell (neuron, muscle, or secretory cell) and the effects of this activation on the postsynaptic membrane potential and ionic composition of the postsynaptic cytosol. This process encompasses both spontaneous and evoked release of neurotransmitter and all parts of synaptic vesicle exocytosis. Evoked transmission starts with the arrival of an action potential at the presynapse. ; postsynaptic density membrane : The membrane component of the postsynaptic density. This is the region of the postsynaptic membrane in which the population of neurotransmitter receptors involved in synaptic transmission are concentrated. ; positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G protein-coupled signaling pathway : Any process that increases the concentration of calcium ions in the cytosol that occurs as part of a PLC-activating G protein-coupled receptor signaling pathway. G-protein-activated PLC hydrolyses phosphatidylinositol-bisphosphate (PIP2) to release diacylglycerol (DAG) and inositol trisphosphate (IP3). IP3 then binds to calcium release channels in the endoplasmic reticulum (ER) to trigger calcium ion release into the cytosol. ; regulation of postsynaptic cytosolic calcium ion concentration : Any process that regulates the concentration of calcium in the postsynaptic cytosol. ; G protein-coupled receptor activity involved in regulation of postsynaptic membrane potential : A G protein-coupled receptor activity occurring in the postsynaptic membrane that is part of a GPCR signaling pathway that positively regulates ion channel activity in the postsynaptic membrane. ; neurotransmitter receptor activity involved in regulation of postsynaptic cytosolic calcium ion concentration : Any neurotransmitter receptor activity that is involved in regulating the concentration of calcium in the postsynaptic cytosol. ; G protein-coupled receptor dimeric complex : A protein complex that contains two G protein-coupled receptors. ; G protein-coupled receptor homodimeric complex : A protein complex that contains two G protein-coupled receptors (GPCRs) of the same subtype. Formation of a GPCR homodimer may be important for the transport of newly formed receptors to the cell surface, and the function of the receptor. ; G protein-coupled neurotransmitter receptor activity involved in regulation of postsynaptic cytosolic calcium ion concentration : A G protein-coupled neurotransmitter receptor activity occurring in the postsynaptic membrane, that is involved in regulating the cytosolic concentration of calcium ions in the postsynapse. ; locomotory behavior : The specific movement from place to place of an organism in response to external or internal stimuli. Locomotion of a whole organism in a manner dependent upon some combination of that organism's internal state and external conditions. ; sensory perception of pain : The series of events required for an organism to receive a painful stimulus, convert it to a molecular signal, and recognize and characterize the signal. Pain is medically defined as the physical sensation of discomfort or distress caused by injury or illness, so can hence be described as a harmful stimulus which signals current (or impending) tissue damage. Pain may come from extremes of temperature, mechanical damage, electricity or from noxious chemical substances. This is a neurological process. ; positive regulation of MAPK cascade : Any process that activates or increases the frequency, rate or extent of signal transduction mediated by the MAPK cascade. ; regulation of sensory perception of pain : Any process that modulates the frequency, rate or extent of the sensory perception of pain, the series of events required for an organism to receive a painful stimulus, convert it to a molecular signal, and recognize and characterize the signal. ; cellular response to electrical stimulus : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an electrical stimulus. ; L-glutamate import across plasma membrane : The directed movement of L-glutamate from outside of a cell, across the plasma membrane and into the cytosol. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; postsynaptic density : An electron dense network of proteins within and adjacent to the postsynaptic membrane of an asymmetric, neuron-neuron synapse. Its major components include neurotransmitter receptors and the proteins that spatially and functionally organize them such as anchoring and scaffolding molecules, signaling enzymes and cytoskeletal components. ; dendrite : A neuron projection that has a short, tapering, morphology. Dendrites receive and integrate signals from other neurons or from sensory stimuli, and conduct nerve impulses towards the axon or the cell body. In most neurons, the impulse is conveyed from dendrites to axon via the cell body, but in some types of unipolar neuron, the impulse does not travel via the cell body. ; neuron projection : A prolongation or process extending from a nerve cell, e.g. an axon or dendrite. ; Schaffer collateral - CA1 synapse : A synapse between the Schaffer collateral axon of a CA3 pyramidal cell and a CA1 pyramidal cell. ; glutamatergic synapse : A synapse that uses glutamate as a neurotransmitter. ;


Symbol
GRM1
Name
glutamate metabotropic receptor 1
Entrez ID
2911
Ensembl ID
ENSG00000152822    (more details)
KEGG ID
hsa:2911    (more details)
OMIM ID
604473
Uniprot ID
Q13255  
GO ID
hsa:2911    (more details)
Chromosome
1
Strand
1
Start
209900923
End
210171389
miRNA Interactions
hsa-miR-212-3p (RPM: 7.7608) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-1285-3p (RPM: 7.2094) / hsa-miR-5189-5p (RPM: 0.665) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-612 (RPM: 0.0216) / hsa-miR-5193 (RPM: 0.0094) / hsa-miR-660-3p (RPM: 0.609) / hsa-miR-5196-3p (RPM: 0.011) / hsa-miR-4505 (RPM: 0.004) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-3187-5p (RPM: 0.0504) / hsa-miR-6860 (RPM: 0.0058) / hsa-miR-5787 (RPM: 0.0012) / hsa-miR-6862-5p (RPM: 0.29) /
Involved Diseases
Posterior capsule opacification (PCO) /
Involved Pathways
Nuclear signaling by ERBB4 /
Sequence
ATGGTCGGGCTCCTTTTGTTTTTTTTCCCAGCGATCTTTTTGGAGGTGTCCCTTCTCCCCAGAAGCCCCGGCAGGAAAGTGTTGCTGGCAGGAGCGTCGTCTCAGCGCTCGGTGGCCAGAATGGACGGAGATGTCATCATTGGAGCCCTCTTCTCAGTCCATCACCAGCCTCCGGCCGAGAAAGTGCCCGAGAGGAAGTGTGGGGAGATCAGGGAGCAGTATGGCATCCAGAGGGTGGAGGCCATGTTCCACACGTTGGATAAGATCAACGCGGACCCGGTCCTCCTGCCCAACATCACCCTGGGCAGTGAGATCCGGGACTCCTGCTGGCACTCTTCCGTGGCTCTGGAACAGAGCATTGAGTTCATTAGGGACTCTCTGATTTCCATTCGAGATGAGAAGGATGGGATCAACCGGTGTCTGCCTGACGGCCAGTCCCTCCCCCCAGGCAGGACTAAGAAGCCCATTGCGGGAGTGATCGGTCCCGGCTCCAGCTCTGTAGCCATTCAAGTGCAGAACCTGCTCCAGCTCTTCGACATCCCCCAGATCGCTTATTCAGCCACAAGCATCGACCTGAGTGACAAAACTTTGTACAAATACTTCCTGAGGGTTGTCCCTTCTGACACTTTGCAGGCAAGGGCCATGCTTGACATAGTCAAACGTTACAATTGGACCTATGTCTCTGCAGTCCACACGGAAGGGAATTATGGGGAGAGCGGAATGGACGCTTTCAAAGAGCTGGCTGCCCAGGAAGGCCTCTGTATCGCCCATTCTGACAAAATCTACAGCAACGCTGGGGAGAAGAGCTTTGACCGACTCTTGCGCAAACTCCGAGAGAGGCTTCCCAAGGCTAGAGTGGTGGTCTGCTTCTGTGAAGGCATGACAGTGCGAGGACTCCTGAGCGCCATGCGGCGCCTTGGCGTCGTGGGCGAGTTCTCACTCATTGGAAGTGATGGATGGGCAGACAGAGATGAAGTCATTGAAGGTTATGAGGTGGAAGCCAACGGGGGAATCACGATAAAGCTGCAGTCTCCAGAGGTCAGGTCATTTGATGATTATTTCCTGAAACTGAGGCTGGACACTAACACGAGGAATCCCTGGTTCCCTGAGTTCTGGCAACATCGGTTCCAGTGCCGCCTTCCAGGACACCTTCTGGAAAATCCCAACTTTAAACGAATCTGCACAGGCAATGAAAGCTTAGAAGAAAACTATGTCCAGGACAGTAAGATGGGGTTTGTCATCAATGCCATCTATGCCATGGCACATGGGCTGCAGAACATGCACCATGCCCTCTGCCCTGGCCACGTGGGCCTCTGCGATGCCATGAAGCCCATCGACGGCAGCAAGCTGCTGGACTTCCTCATCAAGTCCTCATTCATTGGAGTATCTGGAGAGGAGGTGTGGTTTGATGAGAAAGGAGACGCTCCTGGAAGGTATGATATCATGAATCTGCAGTACACTGAAGCTAATCGCTATGACTATGTGCACGTTGGAACCTGGCATGAAGGAGTGCTGAACATTGATGATTACAAAATCCAGATGAACAAGAGTGGAGTGGTGCGGTCTGTGTGCAGTGAGCCTTGCTTAAAGGGCCAGATTAAGGTTATACGGAAAGGAGAAGTGAGCTGCTGCTGGATTTGCACGGCCTGCAAAGAGAATGAATATGTGCAAGATGAGTTCACCTGCAAAGCTTGTGACTTGGGATGGTGGCCCAATGCAGATCTAACAGGCTGTGAGCCCATTCCTGTGCGCTATCTTGAGTGGAGCAACATCGAATCCATTATAGCCATCGCCTTTTCATGCCTGGGAATCCTTGTTACCTTGTTTGTCACCCTAATCTTTGTACTGTACCGGGACACACCAGTGGTCAAATCCTCCAGTCGGGAGCTCTGCTACATCATCCTAGCTGGCATCTTCCTTGGTTATGTGTGCCCATTCACTCTCATTGCCAAACCTACTACCACCTCCTGCTACCTCCAGCGCCTCTTGGTTGGCCTCTCCTCTGCGATGTGCTACTCTGCTTTAGTGACTAAAACCAATCGTATTGCACGCATCCTGGCTGGCAGCAAGAAGAAGATCTGCACCCGGAAGCCCAGGTTCATGAGTGCCTGGGCTCAGGTGATCATTGCCTCAATTCTGATTAGTGTGCAACTAACCCTGGTGGTAACCCTGATCATCATGGAACCCCCTATGCCCATTCTGTCCTACCCAAGTATCAAGGAAGTCTACCTTATCTGCAATACCAGCAACCTGGGTGTGGTGGCCCCTTTGGGCTACAATGGACTCCTCATCATGAGCTGTACCTACTATGCCTTCAAGACCCGCAACGTGCCCGCCAACTTCAACGAGGCCAAATATATCGCGTTCACCATGTACACCACCTGTATCATCTGGCTAGCTTTTGTGCCCATTTACTTTGGGAGCAACTACAAGATCATCACAACTTGCTTTGCAGTGAGTCTCAGTGTAACAGTGGCTCTGGGGTGCATGTTCACTCCCAAGATGTACATCATTATTGCCAAGCCTGAGAGGAATGTCCGCAGTGCCTTCACCACCTCTGATGTTGTCCGCATGCATGTTGGCGATGGCAAGCTGCCCTGCCGCTCCAACACTTTCCTCAACATCTTCCGAAGAAAGAAGGCAGGGGCAGGGAATGCCAATTCTAATGGCAAGTCTGTGTCATGGTCTGAACCAGGTGGAGGACAGGTGCCCAAGGGACAGCATATGTGGCACCGCCTCTCTGTGCACGTGAAGACCAATGAGACGGCCTGCAACCAAACAGCCGTCATCAAGCCCCTCACTAAAAGTTACCAAGGCTCTGGCAAGAGCCTGACCTTTTCAGATACCAGCACCAAGACCCTTTACAACGTAGAGGAGGAGGAGGATGCCCAGCCGATTCGCTTTAGCCCGCCTGGTAGCCCTTCCATGGTGGTGCACAGGCGCGTGCCAAGCGCGGCGACCACTCCGCCTCTGCCGTCCCACCTGACCGCAGAGGAGACCCCCCTCTTCCTGGCCGAACCAGCCCTCCCCAAGGGCTTGCCCCCTCCTCTCCAGCAGCAGCAGCAACCCCCTCCACAGCAGAAATCGCTGATGGACCAGCTCCAGGGAGTGGTCAGCAACTTCAGTACCGCGATCCCGGATTTTCACGCGGTGCTGGCAGGCCCCGGTGGTCCCGGGAACGGGCTGCGGTCCCTGTACCCGCCCCCGCCACCTCCGCAGCACCTGCAGATGCTGCCGCTGCAGCTGAGCACCTTTGGGGAGGAGCTGGTCTCCCCGCCCGCGGACGACGACGACGACAGCGAGAGGTTTAAGCTCCTCCAGGAGTACGTGTATGAGCACGAGCGGGAAGGGAACACGGAAGAAGACGAACTGGAAGAGGAGGAGGAGGACCTGCAGGCGGCCAGCAAACTGACCCCGGATGATTCGCCTGCGCTGACGCCTCCGTCGCCTTTCCGCGACTCGGTGGCCTCGGGCAGCTCGGTGCCCAGCTCCCCCGTGTCCGAGTCGGTGCTCTGCACCCCTCCCAACGTATCCTACGCCTCTGTCATTCTGCGGGACTACAAGCAAAGCTCTTCCACCCTGTAA

Back to List