Details for gene: STUB1


protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; ubiquitin-protein transferase activity : Catalysis of the transfer of ubiquitin from one protein to another via the reaction X-Ub + Y --> Y-Ub + X, where both X-Ub and Y-Ub are covalent linkages. ; protein ubiquitination : The process in which one or more ubiquitin groups are added to a protein. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; transferase activity : Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2. ; nucleoplasm : That part of the nuclear content other than the chromosomes or the nucleolus. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; DNA repair : The process of restoring DNA after damage. Genomes are subject to damage by chemical and physical agents in the environment (e.g. UV and ionizing radiations, chemical mutagens, fungal and bacterial toxins, etc.) and by free radicals or alkylating agents endogenously generated in metabolism. DNA is also damaged because of errors during its replication. A variety of different DNA repair pathways have been reported that include direct reversal, base excision repair, nucleotide excision repair, photoreactivation, bypass, double-strand break repair pathway, and mismatch repair pathway. ; cellular response to DNA damage stimulus : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating damage to its DNA from environmental insults or errors during metabolism. ; protein homodimerization activity : Interacting selectively and non-covalently with an identical protein to form a homodimer. ; protein autoubiquitination : The ubiquitination by a protein of one or more of its own amino acid residues, or residues on an identical protein. Ubiquitination occurs on the lysine residue by formation of an isopeptide crosslink. ; ubiquitin-dependent protein catabolic process : The chemical reactions and pathways resulting in the breakdown of a protein or peptide by hydrolysis of its peptide bonds, initiated by the covalent attachment of a ubiquitin group, or multiple ubiquitin groups, to the protein. ; ubiquitin protein ligase activity : Catalysis of the transfer of ubiquitin to a substrate protein via the reaction X-ubiquitin + S -> X + S-ubiquitin, where X is either an E2 or E3 enzyme, the X-ubiquitin linkage is a thioester bond, and the S-ubiquitin linkage is an amide bond: an isopeptide bond between the C-terminal glycine of ubiquitin and the epsilon-amino group of lysine residues in the substrate or, in the linear extension of ubiquitin chains, a peptide bond the between the C-terminal glycine and N-terminal methionine of ubiquitin residues. ; proteasome-mediated ubiquitin-dependent protein catabolic process : The chemical reactions and pathways resulting in the breakdown of a protein or peptide by hydrolysis of its peptide bonds, initiated by the covalent attachment of ubiquitin, and mediated by the proteasome. ; protein polyubiquitination : Addition of multiple ubiquitin groups to a protein, forming a ubiquitin chain. ; enzyme binding : Interacting selectively and non-covalently with any enzyme. ; ubiquitin-dependent ERAD pathway : The series of steps necessary to target endoplasmic reticulum (ER)-resident proteins for degradation by the cytoplasmic proteasome. Begins with recognition of the ER-resident protein, includes retrotranslocation (dislocation) of the protein from the ER to the cytosol, protein ubiquitination necessary for correct substrate transfer, transport of the protein to the proteasome, and ends with degradation of the protein by the cytoplasmic proteasome. ; endoplasmic reticulum : The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached). ; chaperone binding : Interacting selectively and non-covalently with a chaperone protein, a class of proteins that bind to nascent or unfolded polypeptides and ensure correct folding or transport. ; protein K63-linked ubiquitination : A protein ubiquitination process in which a polymer of ubiquitin, formed by linkages between lysine residues at position 63 of the ubiquitin monomers, is added to a protein. K63-linked ubiquitination does not target the substrate protein for degradation, but is involved in several pathways, notably as a signal to promote error-free DNA postreplication repair. ; Hsp70 protein binding : Interacting selectively and non-covalently with Hsp70 proteins, any of a group of heat shock proteins around 70kDa in size. ; Z disc : Platelike region of a muscle sarcomere to which the plus ends of actin filaments are attached. ; SMAD binding : Interacting selectively and non-covalently with a SMAD signaling protein. ; Hsp90 protein binding : Interacting selectively and non-covalently with Hsp90 proteins, any of a group of heat shock proteins around 90kDa in size. ; tau protein binding : Interacting selectively and non-covalently with tau protein. tau is a microtubule-associated protein, implicated in Alzheimer's disease, Down Syndrome and ALS. ; ubiquitin ligase complex : A protein complex that includes a ubiquitin-protein ligase and enables ubiquitin protein ligase activity. The complex also contains other proteins that may confer substrate specificity on the complex. ; regulation of protein stability : Any process that affects the structure and integrity of a protein, altering the likelihood of its degradation or aggregation. ; positive regulation of protein ubiquitination : Any process that activates or increases the frequency, rate or extent of the addition of ubiquitin groups to a protein. ; negative regulation of transforming growth factor beta receptor signaling pathway : Any process that stops, prevents, or reduces the frequency, rate or extent of any TGF-beta receptor signaling pathway. ; ubiquitin protein ligase binding : Interacting selectively and non-covalently with a ubiquitin protein ligase enzyme, any of the E3 proteins. ; G protein-coupled receptor binding : Interacting selectively and non-covalently with a G protein-coupled receptor. ; kinase binding : Interacting selectively and non-covalently with a kinase, any enzyme that catalyzes the transfer of a phosphate group. ; response to ischemia : Any process that results in a change in state or activity of an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a inadequate blood supply. ; ubiquitin-ubiquitin ligase activity : Isoenergetic transfer of ubiquitin from one protein to an existing ubiquitin chain via the reaction X-ubiquitin + Y-ubiquitin -> Y-ubiquitin-ubiquitin + X, where both the X-ubiquitin and Y-ubiquitin-ubiquitin linkages are thioester bonds between the C-terminal glycine of ubiquitin and a sulfhydryl side group of a cysteine residue. ; chaperone complex : A protein complex required for the non-covalent folding or unfolding, maturation, stabilization or assembly or disassembly of macromolecular structures. Usually active during or immediately after completion of translation. Many chaperone complexes contain heat shock proteins. ; misfolded protein binding : Interacting selectively and non-covalently with a misfolded protein. ; ERBB2 signaling pathway : A series of molecular signals initiated by binding of a ligand to a member of the ERBB family of receptors on the surface of a cell, where the signal is transmitted by ERBB2. The pathway ends with regulation of a downstream cellular process, e.g. transcription. ERBB2 receptors are themselves unable to bind to ligands, but act as a signal-amplifying tyrosine kinase within a heterodimeric pair. ; protein quality control for misfolded or incompletely synthesized proteins : The chemical reactions and pathways resulting in the breakdown of misfolded or attenuated proteins. ; ubiquitin conjugating enzyme complex : Any complex that possesses ubiquitin conjugating enzyme activity. ; cellular response to hypoxia : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating lowered oxygen tension. Hypoxia, defined as a decline in O2 levels below normoxic levels of 20.8 - 20.95%, results in metabolic adaptation at both the cellular and organismal level. ; cellular response to misfolded protein : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a misfolded protein stimulus. ; protein-macromolecule adaptor activity : The binding activity of a protein that brings together two or more macromolecules in contact, permitting those molecules to function in a coordinated way. The adaptor can bring together two proteins, or a protein and another macromolecule such as a lipid or a nucleic acid. ; TPR domain binding : Interacting selectively and non-covalently with a tetratricopeptide repeat (TPR) domain of a protein, the consensus sequence of which is defined by a pattern of small and large hydrophobic amino acids and a structure composed of helices. ; heat shock protein binding : Interacting selectively and non-covalently with a heat shock protein, any protein synthesized or activated in response to heat shock. ; ubiquitin-dependent SMAD protein catabolic process : The chemical reactions and pathways resulting in the breakdown of SMAD signaling proteins by ubiquitination and targeting to the proteasome. ; regulation of glucocorticoid metabolic process : Any process that modulates the frequency, rate or extent of the chemical reactions and pathways involving glucocorticoids. ; positive regulation of proteasomal ubiquitin-dependent protein catabolic process : Any process that activates or increases the frequency, rate or extent of the breakdown of a protein or peptide by hydrolysis of its peptide bonds, initiated by the covalent attachment of ubiquitin, and mediated by the proteasome. ; cellular response to heat : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a heat stimulus, a temperature stimulus above the optimal temperature for that organism. ; positive regulation of proteolysis : Any process that activates or increases the frequency, rate or extent of the hydrolysis of a peptide bond or bonds within a protein. ; protein maturation : Any process leading to the attainment of the full functional capacity of a protein. ; positive regulation of chaperone-mediated protein complex assembly : Any process that increases the frequency, rate, or extent of chaperone-mediated protein complex assembly. Chaperone-mediated protein complex assembly is the aggregation, arrangement and bonding together of a set of components to form a protein complex, mediated by chaperone molecules that do not form part of the finished complex. ; nuclear inclusion body : An intranuclear focus at which aggregated proteins have been sequestered. ; endoplasmic reticulum unfolded protein response : The series of molecular signals generated as a consequence of the presence of unfolded proteins in the endoplasmic reticulum (ER) or other ER-related stress; results in changes in the regulation of transcription and translation. ; negative regulation of protein binding : Any process that stops, prevents, or reduces the frequency, rate or extent of protein binding. ; positive regulation of ubiquitin-protein transferase activity : Any process that activates, maintains or increases the rate of ubiquitin transferase activity. ; chaperone-mediated autophagy : The autophagy process which begins when chaperones and co-chaperones recognize a target motif and unfold the substrate protein. The proteins are then transported to the lysosome where they are degraded. ; : ;


Symbol
STUB1
Name
STIP1 homology and U-box containing protein 1
Entrez ID
10273
Ensembl ID
ENSG00000103266    (more details)
KEGG ID
hsa:10273    (more details)
OMIM ID
607207
Uniprot ID
Q9UNE7  
GO ID
hsa:10273    (more details)
Chromosome
10
Strand
1
Start
100232298
End
100267680
miRNA Interactions
hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-942-5p (RPM: 2.297) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-548n (RPM: 0.0924) / hsa-miR-21-5p (RPM: 5494.851) / hsa-miR-196b-5p (RPM: 0.2478) / hsa-miR-20a-3p (RPM: 0.8156) / hsa-miR-196a-5p (RPM: 0.311) / hsa-miR-296-5p (RPM: 12.5874) / hsa-miR-518a-3p (RPM: 0.0704) /
Involved Diseases
Posterior capsule opacification (PCO) /
Involved Pathways
Sequence
ATGAAGGGCAAGGAGGAGAAGGAGGGCGGCGCACGGCTGGGCGCTGGCGGCGGAAGCCCCGAGAAGAGCCCGAGCGCGCAGGAGCTCAAGGAGCAGGGCAATCGTCTGTTCGTGGGCCGAAAGTACCCGGAGGCGGCGGCCTGCTACGGCCGCGCGATCACCCGGAACCCGCTGGTGGCCGTGTATTACACCAACCGGGCCTTGTGCTACCTGAAGATGCAGCAGCACGAGCAGGCCCTGGCCGACTGCCGGCGCGCCCTGGAGCTGGACGGGCAGTCTGTGAAGGCGCACTTCTTCCTGGGGCAGTGCCAGCTGGAGATGGAGAGCTATGATGAGGCCATCGCCAATCTGCAGCGAGCTTACAGCCTGGCCAAGGAGCAGCGGCTGAACTTCGGGGACGACATCCCCAGCGCTCTTCGAATCGCGAAGAAGAAGCGCTGGAACAGCATTGAGGAGCGGCGCATCCACCAGGAGAGCGAGCTGCACTCCTACCTCTCCAGGCTCATTGCCGCGGAGCGTGAGAGGGAGCTGGAAGAGTGCCAGCGAAACCACGAGGGTGATGAGGACGACAGCCACGTCCGGGCCCAGCAGGCCTGCATTGAGGCCAAGCACGACAAGTACATGGCGGACATGGACGAGCTTTTTTCTCAGGTGGATGAGAAGAGGAAGAAGCGAGACATCCCCGACTACCTGTGTGGCAAGATCAGCTTTGAGCTGATGCGGGAGCCGTGCATCACGCCCAGTGGCATCACCTACGACCGCAAGGACATCGAGGAGCACCTGCAGCGTGTGGGTCATTTTGACCCCGTGACCCGGAGCCCCCTGACCCAGGAACAGCTCATCCCCAACTTGGCTATGAAGGAGGTTATTGACGCATTCATCTCTGAGAATGGCTGGGTGGAGGACTACTGA

Back to List