Details for gene: GRID2


membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; ion transport : The directed movement of charged atoms or small charged molecules into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; signaling receptor activity : Receiving a signal and transmitting it in the cell to initiate a change in cell activity. A signal is a physical entity or change in state that is used to transfer information in order to trigger a response. ; ligand-gated ion channel activity : Enables the transmembrane transfer of an ion by a channel that opens when a specific ligand has been bound by the channel complex or one of its constituent parts. ; ion channel activity : Enables the facilitated diffusion of an ion (by an energy-independent process) by passage through a transmembrane aqueous pore or channel without evidence for a carrier-mediated mechanism. May be either selective (it enables passage of a specific ion only) or non-selective (it enables passage of two or more ions of same charge but different size). ; ionotropic glutamate receptor activity : Catalysis of the transmembrane transfer of an ion by a channel that opens when glutamate has been bound by the channel complex or one of its constituent parts. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; ion transmembrane transport : A process in which an ion is transported across a membrane. ; cell junction : A cellular component that forms a specialized region of connection between two or more cells, or between a cell and the extracellular matrix, or between two membrane-bound components of a cell, such as flagella. ; synapse : The junction between an axon of one neuron and a dendrite of another neuron, a muscle fiber or a glial cell. As the axon approaches the synapse it enlarges into a specialized structure, the presynaptic terminal bouton, which contains mitochondria and synaptic vesicles. At the tip of the terminal bouton is the presynaptic membrane; facing it, and separated from it by a minute cleft (the synaptic cleft) is a specialized area of membrane on the receiving cell, known as the postsynaptic membrane. In response to the arrival of nerve impulses, the presynaptic terminal bouton secretes molecules of neurotransmitters into the synaptic cleft. These diffuse across the cleft and transmit the signal to the postsynaptic membrane. ; postsynaptic membrane : A specialized area of membrane facing the presynaptic membrane on the tip of the nerve ending and separated from it by a minute cleft (the synaptic cleft). Neurotransmitters cross the synaptic cleft and transmit the signal to the postsynaptic membrane. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; ionotropic glutamate receptor signaling pathway : A series of molecular signals initiated by glutamate binding to a glutamate receptor on the surface of the target cell, followed by the movement of ions through a channel in the receptor complex. Ends with regulation of a downstream cellular process, e.g. transcription. ; integral component of plasma membrane : The component of the plasma membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; scaffold protein binding : Interacting selectively and non-covalently with a scaffold protein. Scaffold proteins are crucial regulators of many key signaling pathways. Although not strictly defined in function, they are known to interact and/or bind with multiple members of a signaling pathway, tethering them into complexes. ; synaptic transmission, glutamatergic : The vesicular release of glutamate from a presynapse, across a chemical synapse, the subsequent activation of glutamate receptors at the postsynapse of a target cell (neuron, muscle, or secretory cell) and the effects of this activation on the postsynaptic membrane potential and ionic composition of the postsynaptic cytosol. This process encompasses both spontaneous and evoked release of neurotransmitter and all parts of synaptic vesicle exocytosis. Evoked transmission starts with the arrival of an action potential at the presynapse. ; dendritic spine : A small, membranous protrusion from a dendrite that forms a postsynaptic compartment, typically receiving input from a single presynapse. They function as partially isolated biochemical and an electrical compartments. Spine morphology is variable:they can be thin, stubby, mushroom, or branched, with a continuum of intermediate morphologies. They typically terminate in a bulb shape, linked to the dendritic shaft by a restriction. Spine remodeling is though to be involved in synaptic plasticity. ; excitatory synapse assembly : The aggregation, arrangement and bonding together of a set of components to form an excitatory synapse. ; glutamate receptor activity : Combining with glutamate and transmitting the signal from one side of the membrane to the other to initiate a change in cell activity. ; PDZ domain binding : Interacting selectively and non-covalently with a PDZ domain of a protein, a domain found in diverse signaling proteins. ; transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential : Any transmitter-gated ion channel activity that is involved in regulation of postsynaptic membrane potential. ; heterophilic cell-cell adhesion via plasma membrane cell adhesion molecules : The attachment of an adhesion molecule in one cell to a nonidentical adhesion molecule in an adjacent cell. ; glutamate receptor signaling pathway : A series of molecular signals initiated by the binding of glutamate to a glutamate receptor on the surface of a target cell, and ending with regulation of a downstream cellular process, e.g. transcription. ; regulation of neuron projection development : Any process that modulates the rate, frequency or extent of neuron projection development. Neuron projection development is the process whose specific outcome is the progression of a neuron projection over time, from its formation to the mature structure. A neuron projection is any process extending from a neural cell, such as axons or dendrites (collectively called neurites). ; cerebellar granule cell differentiation : The process in which neuroblasts acquire specialized structural and/or functional features that characterize the mature cerebellar granule cell. Differentiation includes the processes involved in commitment of a neuroblast to a granule cell fate. A granule cell is a glutamatergic interneuron found in the cerebellar cortex. ; cellular protein localization : Any process in which a protein is transported to, and/or maintained in, a specific location at the level of a cell. Localization at the cellular level encompasses movement within the cell, from within the cell to the cell surface, or from one location to another at the surface of a cell. ; regulation of neuron apoptotic process : Any process that modulates the occurrence or rate of cell death by apoptotic process in neurons. ; modulation of chemical synaptic transmission : Any process that modulates the frequency or amplitude of synaptic transmission, the process of communication from a neuron to a target (neuron, muscle, or secretory cell) across a synapse. Amplitude, in this case, refers to the change in postsynaptic membrane potential due to a single instance of synaptic transmission. ; positive regulation of synapse assembly : Any process that activates, maintains or increases the frequency, rate or extent of synapse assembly, the aggregation, arrangement and bonding together of a set of components to form a synapse. ; excitatory postsynaptic potential : A process that leads to a temporary increase in postsynaptic potential due to the flow of positively charged ions into the postsynaptic cell. The flow of ions that causes an EPSP is an excitatory postsynaptic current (EPSC) and makes it easier for the neuron to fire an action potential. ; prepulse inhibition : The process in which a startle magnitude is reduced when the startling stimulus is preceded by a low-intensity prepulse. ; regulation of postsynaptic density assembly : Any process that modulates the frequency, rate or extent of postsynaptic density assembly, the aggregation, arrangement and bonding together of a set of components to form a postsynaptic density. ; positive regulation of long-term synaptic depression : Any process that activates or increases the frequency, rate or extent of long term synaptic depression. ; ionotropic glutamate receptor complex : A multimeric assembly of four or five subunits which form a structure with an extracellular N-terminus and a large loop that together form the ligand binding domain. The C-terminus is intracellular. The ionotropic glutamate receptor complex itself acts as a ligand-gated ion channel; on binding glutamate, charged ions pass through a channel in the center of the receptor complex. ; somatodendritic compartment : The region of a neuron that includes the cell body (cell soma) and dendrite(s), but excludes the axon. ; parallel fiber to Purkinje cell synapse : An excitatory synapse formed by the parallel fibers of granule cells synapsing onto the dendrites of Purkinje cells. ; glutamatergic synapse : A synapse that uses glutamate as a neurotransmitter. ; integral component of postsynaptic density membrane : The component of the postsynaptic density membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; : ; cellular anatomical entity : A part of a cellular organism that is either an immaterial entity or a material entity with granularity above the level of a protein complex but below that of an anatomical system. Or, a substance produced by a cellular organism with granularity above the level of a protein complex. ;


Symbol
GRID2
Name
glutamate ionotropic receptor delta type subunit 2
Entrez ID
2895
Ensembl ID
ENSG00000152208    (more details)
KEGG ID
hsa:2895    (more details)
OMIM ID
602368
Uniprot ID
O43424  
GO ID
hsa:2895    (more details)
Chromosome
11
Strand
1
Start
65525077
End
65538704
miRNA Interactions
hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-448 (RPM: 1.696) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-3924 (RPM: 0.0066) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-190a-3p (RPM: 0.756) /
Involved Diseases
Posterior capsule opacification (PCO) /
Involved Pathways
Sequence
ATGGAAGTTTTCCCCTTTCTCTTGGTTTTGTCCGTCTGGTGGTCTCGAACCTGGGACTCGGCGAATGCGGATTCGATCATTCACATCGGAGCAATTTTTGATGAATCTGCCAAAAAGGATGATGAGGTATTTCGCACTGCGGTTGGTGACCTTAACCAGAATGAGGAGATCTTACAGACTGAGAAAATCACATTTTCAGTGACGTTTGTTGATGGCAACAACCCTTTCCAAGCAGTTCAAGAAGCCTGTGAACTTATGAATCAAGGCATCTTGGCCCTGGTCAGCTCCATTGGCTGCACGTCAGCAGGATCCCTCCAGTCTTTGGCAGACGCCATGCATATCCCCCACCTCTTCATTCAGCGCTCAACAGCTGGGACCCCAAGGAGTGGCTGTGGACTCACCCGGAGCAACAGGAATGATGACTACACTCTCTCAGTTCGCCCACCTGTCTACTTGCATGATGTTATCCTAAGAGTGGTCACAGAGTATGCCTGGCAGAAATTCATTATATTCTATGATAGTGAATACGATATCCGTGGAATACAGGAGTTCTTGGACAAAGTCTCTCAGCAGGGAATGGATGTTGCACTTCAGAAGGTAGAAAACAACATCAATAAAATGATTACCACTCTCTTTGACACCATGAGAATAGAAGAACTGAATCGCTATCGAGACACTCTTAGGCGAGCGATCCTTGTTATGAATCCTGCTACAGCCAAATCCTTCATTACTGAGGTTGTGGAGACTAATTTGGTTGCTTTTGACTGTCACTGGATCATTATAAATGAGGAAATAAACGATGTGGACGTACAGGAACTTGTAAGAAGGTCAATTGGAAGGTTAACGATTATTCGGCAGACATTTCCAGTTCCCCAGAACATAAGTCAGCGGTGTTTCCGTGGCAACCATCGAATATCTTCAACATTGTGTGATCCAAAGGATCCATTTGCTCAGAATATGGAGATTTCCAACCTTTACATATATGACACGGTGCTTCTGCTTGCTAATGCTTTTCATAAGAAGCTGGAGGACCGAAAGTGGCACAGCATGGCAAGTCTGTCATGTATCAGAAAGAACTCAAAGCCCTGGCAGGGTGGGCGCTCCATGTTGGAGACCATCAAGAAGGGTGGAGTTAGTGGGTTGACTGGAGAGCTAGAATTTGGAGAAAATGGAGGCAATCCCAATGTCCACTTTGAAATCCTTGGAACCAACTATGGAGAAGAGCTTGGCAGAGGTGTTCGAAAACTTGGTTGCTGGAATCCTGTCACAGGTCTGAATGGGTCACTGACTGACAAGAAATTGGAGAATAACATGCGTGGAGTGGTTCTACGTGTAGTAACTGTTCTGGAAGAACCTTTTGTGATGGTCTCTGAAAATGTCTTGGGTAAGCCGAAGAAATACCAGGGCTTCTCCATTGATGTTTTGGATGCCTTATCTAACTACCTGGGTTTTAACTACGAAATTTACGTAGCACCGGATCACAAATACGGAAGCCCACAAGAAGATGGGACATGGAATGGCTTGGTAGGAGAACTTGTCTTTAAGAGAGCCGACATAGGGATTTCTGCTTTAACCATCACTCCAGATCGTGAAAATGTGGTGGACTTTACGACACGTTACATGGACTACTCAGTGGGGGTACTACTTCGAAGGGCTGAAAAGACAGTGGATATGTTTGCCTGTCTTGCACCATTTGATCTCTCTCTATGGGCTTGCATTGCTGGCACAGTCCTTCTGGTGGGTCTACTGGTCTACCTCTTGAACTGGCTTAATCCCCCACGATTACAAATGGGATCAATGACGTCTACTACTCTCTACAACTCCATGTGGTTTGTGTATGGATCTTTTGTACAACAAGGCGGGGAAGTCCCGTACACGACTCTGGCTACCCGAATGATGATGGGGGCTTGGTGGCTATTTGCTTTGATTGTTATCTCATCTTACACGGCAAACCTCGCTGCTTTCCTCACTATTACACGCATTGAAAGTTCCATCCAGTCTCTCCAGGACCTTTCCAAGCAAACAGAAATCCCTTATGGCACAGTCCTAGACTCTGCGGTATATGAGCATGTCCGCATGAAAGGACTGAATCCTTTTGAGAGGGACAGCATGTATTCCCAAATGTGGCGGATGATCAACCGAAGCAATGGATCGGAGAACAATGTTCTGGAGTCCCAGGCAGGCATTCAAAAGGTAAAATATGGAAATTATGCTTTCGTATGGGATGCAGCTGTATTGGAATATGTGGCTATCAATGACCCAGATTGTTCCTTTTACACCATTGGAAATACTGTTGCTGATCGGGGATATGGAATTGCATTACAACATGGCAGTCCTTACCGAGATGTTTTTTCACAAAGGATCCTGGAGCTTCAGCAGAATGGTGACATGGACATCCTGAAGCACAAATGGTGGCCTAAGAATGGCCAGTGTGACCTGTACTCGTCAGTGGACACAAAGCAGAAAGGAGGCGCCCTGGACATAAAGAGCTTTGCAGGGGTCTTTTGTATCCTGGCTGCTGGAATTGTCCTCTCCTGCTTCATAGCCATGCTGGAGACGTGGTGGAACAAGAGGAAAGGCTCCCGGGTTCCATCAAAAGAGGATGACAAGGAAATTGACCTGGAGCACCTCCATAGACGTGTAAATAGCTTGTGCACAGATGACGACAGCCCCCATAAACAGTTTTCCACCTCGTCAATTGATTTGACCCCTCTGGACATTGACACTTTGCCAACACGACAAGCACTGGAGCAAATCAGTGATTTCAGGAACACTCATATTACCACAACAACCTTTATCCCAGAGCAGATCCAGACTCTTAGCCGCACACTGTCAGCTAAAGCTGCTTCTGGTTTCACTTTTGGCAACGTGCCTGAGCACCGAACTGGCCCTTTTAGGCACAGGGCACCTAATGGGGGCTTTTTCAGGAGTCCTATAAAAACAATGTCATCTATTCCTTATCAACCAACTCCTACCCTGGGGCTCAATCTGGGTAATGATCCAGACCGAGGCACCTCCATATGA

Back to List