Details for gene: SLC9A1


integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; transmembrane transport : The process in which a solute is transported across a lipid bilayer, from one side of a membrane to the other. ; sodium ion transport : The directed movement of sodium ions (Na+) into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; sodium:proton antiporter activity : Enables the transfer of a solute or solutes from one side of a membrane to the other according to the reaction: Na+(out) + H+(in) = Na+(in) + H+(out). ; regulation of pH : Any process involved in the maintenance of an internal equilibrium of hydrogen ions, thereby modulating the internal pH, within an organism or cell. ; cation transport : The directed movement of cations, atoms or small molecules with a net positive charge, into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; solute:proton antiporter activity : Enables the transfer of a solute or solutes from one side of a membrane to the other according to the reaction: solute(out) + H+(in) = solute(in) + H+(out). ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; endoplasmic reticulum : The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached). ; endoplasmic reticulum membrane : The lipid bilayer surrounding the endoplasmic reticulum. ; nucleoplasm : That part of the nuclear content other than the chromosomes or the nucleolus. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; ion transport : The directed movement of charged atoms or small charged molecules into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; focal adhesion : A cell-substrate junction that anchors the cell to the extracellular matrix and that forms a point of termination of actin filaments. In insects focal adhesion has also been referred to as hemi-adherens junction (HAJ). ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; antiporter activity : Enables the active transport of a solute across a membrane by a mechanism whereby two or more species are transported in opposite directions in a tightly coupled process not directly linked to a form of energy other than chemiosmotic energy. The reaction is: solute A(out) + solute B(in) = solute A(in) + solute B(out). ; anion transmembrane transport : The process in which an anion is transported across a membrane. ; calmodulin binding : Interacting selectively and non-covalently with calmodulin, a calcium-binding protein with many roles, both in the calcium-bound and calcium-free states. ; potassium ion transmembrane transport : A process in which a potassium ion is transported from one side of a membrane to the other. ; extracellular exosome : A vesicle that is released into the extracellular region by fusion of the limiting endosomal membrane of a multivesicular body with the plasma membrane. Extracellular exosomes, also simply called exosomes, have a diameter of about 40-100 nm. ; calcium-dependent protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules), in the presence of calcium. ; molecular adaptor activity : The binding activity of a molecule that brings together two or more molecules through a selective, non-covalent, often stoichiometric interaction, permitting those molecules to function in a coordinated way. ; positive regulation of transcription by RNA polymerase II : Any process that activates or increases the frequency, rate or extent of transcription from an RNA polymerase II promoter. ; lamellipodium : A thin sheetlike process extended by the leading edge of a migrating cell or extending cell process; contains a dense meshwork of actin filaments. ; regulation of cardiac muscle cell membrane potential : Any process that modulates the establishment or extent of a membrane potential in a cardiac muscle cell (a cardiomyocyte). A membrane potential is the electric potential existing across any membrane arising from charges in the membrane itself and from the charges present in the media on either side of the membrane. ; response to acidic pH : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a pH stimulus with pH < 7. pH is a measure of the acidity or basicity of an aqueous solution. ; protein complex oligomerization : The process of creating protein oligomers, compounds composed of a small number, usually between three and ten, of component monomers; protein oligomers may be composed of different or identical monomers. Oligomers may be formed by the polymerization of a number of monomers or the depolymerization of a large protein polymer. ; protein-macromolecule adaptor activity : The binding activity of a protein that brings together two or more macromolecules in contact, permitting those molecules to function in a coordinated way. The adaptor can bring together two proteins, or a protein and another macromolecule such as a lipid or a nucleic acid. ; response to muscle stretch : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a myofibril being extended beyond its slack length. ; cell migration : The controlled self-propelled movement of a cell from one site to a destination guided by molecular cues. Cell migration is a central process in the development and maintenance of multicellular organisms. ; integral component of plasma membrane : The component of the plasma membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; membrane raft : Any of the small (10-200 nm), heterogeneous, highly dynamic, sterol- and sphingolipid-enriched membrane domains that compartmentalize cellular processes. Small rafts can sometimes be stabilized to form larger platforms through protein-protein and protein-lipid interactions. ; positive regulation of cardiac muscle hypertrophy : Any process that increases the rate, frequency or extent of the enlargement or overgrowth of all or part of the heart due to an increase in size (not length) of individual cardiac muscle fibers, without cell division. ; regulation of intracellular pH : Any process that modulates the internal pH of a cell, measured by the concentration of the hydrogen ion. ; cellular sodium ion homeostasis : Any process involved in the maintenance of an internal steady state of sodium ions at the level of a cell. ; regulation of cardiac muscle contraction by calcium ion signaling : Any process that modulates the frequency, rate or extent of cardiac muscle contraction by changing the calcium ion signals that trigger contraction. ; positive regulation of calcium:sodium antiporter activity : Any process that activates or increases the frequency, rate or extent of calcium:sodium antiporter activity. ; cellular response to epinephrine stimulus : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an epinephrine stimulus. Epinephrine is a catecholamine that has the formula C9H13NO3; it is secreted by the adrenal medulla to act as a hormone, and released by certain neurons to act as a neurotransmitter active in the central nervous system. ; phosphatidylinositol-4,5-bisphosphate binding : Interacting selectively and non-covalently with phosphatidylinositol-4,5-bisphosphate, a derivative of phosphatidylinositol in which the inositol ring is phosphorylated at the 4' and 5' positions. ; potassium:proton antiporter activity : Enables the transfer of a solute or solutes from one side of a membrane to the other according to the reaction: K+(in) + H+(out) = K+(out) + H+(in). ; protein phosphatase 2B binding : Interacting selectively and non-covalently with the enzyme protein phosphatase 2B. ; sodium:proton antiporter activity involved in regulation of cardiac muscle cell membrane potential : Enables the transfer of a solute or solutes from one side of a cardiac muscle cell membrane to the other according to the reaction: Na+(out) + H+(in) = Na+(in) + H+(out). This transfer contributes to the regulation of the cardiac muscle cell plasma membrane potential. ; regulation of the force of heart contraction : Any process that modulates the extent of heart contraction, changing the force with which blood is propelled. ; response to organic cyclic compound : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an organic cyclic compound stimulus. ; maintenance of cell polarity : The maintenance of established anisotropic intracellular organization or cell growth patterns. ; cell differentiation : The process in which relatively unspecialized cells, e.g. embryonic or regenerative cells, acquire specialized structural and/or functional features that characterize the cells, tissues, or organs of the mature organism or some other relatively stable phase of the organism's life history. Differentiation includes the processes involved in commitment of a cell to a specific fate and its subsequent development to the mature state. ; positive regulation of cell growth : Any process that activates or increases the frequency, rate, extent or direction of cell growth. ; cellular response to insulin stimulus : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an insulin stimulus. Insulin is a polypeptide hormone produced by the islets of Langerhans of the pancreas in mammals, and by the homologous organs of other organisms. ; positive regulation of mitochondrial membrane permeability : Any process that increases the frequency, rate or extent of the passage or uptake of molecules by the mitochondrial membrane. ; sodium ion export across plasma membrane : The directed movement of sodium ions from inside of a cell, across the plasma membrane and into the extracellular region. ; positive regulation of apoptotic process : Any process that activates or increases the frequency, rate or extent of cell death by apoptotic process. ; negative regulation of apoptotic process : Any process that stops, prevents, or reduces the frequency, rate or extent of cell death by apoptotic process. ; positive regulation of action potential : Any process that activates or increases the frequency, rate or extent of action potential creation, propagation or termination. This typically occurs via modulation of the activity or expression of voltage-gated ion channels. ; regulation of stress fiber assembly : Any process that modulates the frequency, rate or extent of the assembly of a stress fiber, a bundle of microfilaments and other proteins found in fibroblasts. ; regulation of focal adhesion assembly : Any process that modulates the frequency, rate or extent of focal adhesion formation, the establishment and maturation of focal adhesions. ; regulation of sensory perception of pain : Any process that modulates the frequency, rate or extent of the sensory perception of pain, the series of events required for an organism to receive a painful stimulus, convert it to a molecular signal, and recognize and characterize the signal. ; cardiac muscle cell differentiation : The process in which a cardiac muscle precursor cell acquires specialized features of a cardiac muscle cell. Cardiac muscle cells are striated muscle cells that are responsible for heart contraction. ; cellular response to cold : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a cold stimulus, a temperature stimulus below the optimal temperature for that organism. ; positive regulation of calcineurin-NFAT signaling cascade : Any process that activates or increases the frequency, rate or extent of signaling via the calcineurin-NFAT signaling cascade. ; neuron death : The process of cell death in a neuron. ; cellular response to antibiotic : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an antibiotic stimulus. An antibiotic is a chemical substance produced by a microorganism which has the capacity to inhibit the growth of or to kill other microorganisms. ; cellular response to electrical stimulus : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an electrical stimulus. ; cellular response to mechanical stimulus : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a mechanical stimulus. ; cellular response to organic cyclic compound : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an organic cyclic compound stimulus. ; cellular response to hypoxia : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating lowered oxygen tension. Hypoxia, defined as a decline in O2 levels below normoxic levels of 20.8 - 20.95%, results in metabolic adaptation at both the cellular and organismal level. ; cellular response to acidic pH : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a pH stimulus with pH < 7. pH is a measure of the acidity or basicity of an aqueous solution. ; cardiac muscle cell contraction : The actin filament-based process in which cytoplasmic actin filaments slide past one another resulting in contraction of a cardiac muscle cell. ; regulation of the force of heart contraction by cardiac conduction : A cardiac conduction process that modulates the extent of heart contraction, changing the force with which blood is propelled. ; sodium ion import across plasma membrane : The directed movement of sodium ions from outside of a cell, across the plasma membrane and into the cytosol. ; positive regulation of the force of heart contraction : Any process that increases the force of heart muscle contraction. ; positive regulation of intracellular signal transduction : Any process that activates or increases the frequency, rate or extent of intracellular signal transduction. ; proton transmembrane transport : The directed movement of a proton across a membrane. ; mitochondrion : A semiautonomous, self replicating organelle that occurs in varying numbers, shapes, and sizes in the cytoplasm of virtually all eukaryotic cells. It is notably the site of tissue respiration. ; cell surface : The external part of the cell wall and/or plasma membrane. ; intercalated disc : A complex cell-cell junction at which myofibrils terminate in cardiomyocytes; mediates mechanical and electrochemical integration between individual cardiomyocytes. The intercalated disc contains regions of tight mechanical attachment (fasciae adherentes and desmosomes) and electrical coupling (gap junctions) between adjacent cells. ; basolateral plasma membrane : The region of the plasma membrane that includes the basal end and sides of the cell. Often used in reference to animal polarized epithelial membranes, where the basal membrane is the part attached to the extracellular matrix, or in plant cells, where the basal membrane is defined with respect to the zygotic axis. ; apical plasma membrane : The region of the plasma membrane located at the apical end of the cell. ; T-tubule : Invagination of the plasma membrane of a muscle cell that extends inward from the cell surface around each myofibril. The ends of T-tubules make contact with the sarcoplasmic reticulum membrane. ; sarcolemma : The outer membrane of a muscle cell, consisting of the plasma membrane, a covering basement membrane (about 100 nm thick and sometimes common to more than one fiber), and the associated loose network of collagen fibers. ; perinuclear region of cytoplasm : Cytoplasm situated near, or occurring around, the nucleus. ; cation-transporting ATPase complex : Protein complex that carries out the reaction: ATP + H2O + cation(out) = ADP + phosphate + cation(in). ; sodium ion transmembrane transport : A process in which a sodium ion is transported from one side of a membrane to the other by means of some agent such as a transporter or pore. ;


Symbol
SLC9A1
Name
solute carrier family 9 member A1
Entrez ID
6548
Ensembl ID
ENSG00000090020    (more details)
KEGG ID
hsa:6548    (more details)
OMIM ID
107310
Uniprot ID
B2RAH2  
GO ID
hsa:6548    (more details)
Chromosome
1
Strand
-1
Start
27098809
End
27166981
miRNA Interactions
hsa-miR-30c-5p (RPM: 3890.0396) / hsa-miR-15a-5p (RPM: 139.425) / hsa-miR-4533 (RPM: 0.0008) / hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-30d-5p (RPM: 9562.1366) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-15b-5p (RPM: 133.5752) / hsa-miR-30e-5p (RPM: 2305.0396) / hsa-miR-423-5p (RPM: 976.289) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-106b-5p (RPM: 35.4204) / hsa-miR-424-5p (RPM: 9.04) / hsa-miR-101-3p (RPM: 3335.0564) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-5582-3p (RPM: 0.0138) / hsa-miR-19b-3p (RPM: 197.0578) / hsa-miR-19a-3p (RPM: 25.4064) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-92a-3p (RPM: 16961.15) / hsa-miR-92b-3p (RPM: 8345.0264) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-3911 (RPM: 0.0924) / hsa-miR-18b-3p (RPM: 0.2006) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-4725-3p (RPM: 0.1912) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-miR-32-5p (RPM: 14.5562) / hsa-miR-542-3p (RPM: 2.7294) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-214-3p (RPM: 21.2784) / hsa-miR-331-3p (RPM: 130.5788) / hsa-miR-185-5p (RPM: 29.191) / hsa-miR-122-5p (RPM: 0.5028) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-940 (RPM: 4.614) / hsa-let-7g-3p (RPM: 7.0448) / hsa-miR-146b-3p (RPM: 16.408) / hsa-miR-4747-5p (RPM: 0.0074) / hsa-miR-545-3p (RPM: 0.0276) / hsa-miR-574-5p (RPM: 176.4618) / hsa-miR-449c-5p (RPM: 1.8038) / hsa-miR-874-3p (RPM: 170.3494) / hsa-miR-34b-5p (RPM: 1.8778) / hsa-miR-339-3p (RPM: 185.7798) / hsa-miR-423-3p (RPM: 1928.5158) / hsa-miR-6867-5p (RPM: 0.0198) / hsa-miR-3157-3p (RPM: 0.5344) / hsa-miR-6780b-5p (RPM: 0.0222) / hsa-miR-7845-5p (RPM: 0.1418) / hsa-miR-6783-5p (RPM: 0.0136) / hsa-miR-4433b-3p (RPM: 0.0038) / hsa-miR-1249-3p (RPM: 14.5508) /
Involved Diseases
Posterior capsule opacification (PCO) /
Involved Pathways
Neuroactive ligand-receptor interaction / Long-term depression /
Sequence
ATGGTTCTGCGGTCTGGCATCTGTGGCCTCTCTCCACATCGGATCTTCCCTTCCTTACTCGTGGTGGTTGCTTTGGTGGGGCTGCTGCCTGTTCTCAGGAGCCATGGCCTCCAGCTCAGCCCAACTGCCAGCACCATTCGAAGCTCAGAGCCACCACGAGAACGCTCGATTGGGGATGTCACCACCGCTCCACCGGAGGTCACCCCAGAGAGCCGCCCTGTTAATCATTCCGTCACTGATCATGGCATGAAGCCGCGCAAGGCCTTTCCAGTCCTGGGCATCGACTACACACACGTGCGCACCCCCTTCGAGATCTCCCTCTGGATCCTTCTGGCCTGCCTCATGAAGATAGGTTTCCATGTGATCCCCACTATCTCAAGCATCGTCCCGGAGAGCTGCCTGCTGATCGTGGTGGGGCTGCTGGTGGGGGGCCTGATCAAGGGTGTAGGCGAGACACCCCCCTTCCTGCAGTCCGACGTCTTCTTCCTCTTCCTGCTGCCGCCCATCATCCTGGATGCGGGCTACTTCCTGCCACTGCGGCAGTTCACAGAAAACCTGGGCACCATCCTGATCTTTGCCGTGGTGGGCACGCTGTGGAACGCCTTCTTCCTGGGCGGCCTCATGTACGCCGTGTGCCTGGTGGGCGGTGAGCAGATCAACAACATCGGCCTCCTGGACAACCTGCTCTTCGGCAGCATCATCTCGGCCGTGGACCCCGTGGCGGTTCTGGCTGTCTTTGAGGAAATTCACATCAATGAGCTGCTGCACATCCTTGTTTTTGGGGAGTCCTTGCTCAATGACGCCGTCACTGTGGTCCTGTATCACCTCTTTGAGGAGTTTGCCAACTACGAACACGTGGGCATCGTGGACATCTTCCTCGGCTTCCTGAGCTTCTTCGTGGTGGCCCTGGGCGGGGTGCTTGTGGGCGTGGTCTACGGGGTCATCGCAGCCTTCACCTCCCGATTTACCTCCCACATCCGGGTCATCGAGCCGCTCTTCGTCTTCCTCTACAGCTACATGGCCTACTTGTCAGCCGAGCTCTTCCACCTGTCAGGCATCATGGCGCTCATAGCCTCAGGAGTGGTGATGCGCCCCTATGTGGAGGCCAACATCTCCCACAAGTCCCACACCACCATCAAATACTTCCTGAAGATGTGGAGCAGCGTCAGCGAGACCCTCATCTTCATCTTCCTCGGCGTCTCCACGGTGGCCGGCTCCCACCACTGGAACTGGACCTTCGTCATCAGCACCCTGCTCTTCTGCCTCATCGCCCGCGTGCTGGGGGTGCTGGGCCTGACCTGGTTCATCAACAAGTTCCGTATCGTGAAGCTGACCCCCAAGGACCAGTTCATCATCGCCTATGGGGGCCTGCGAGGGGCCATCGCCTTCTCTCTGGGCTACCTCCTGGACAAGAAGCACTTCCCCATGTGTGACCTGTTCCTCACTGCCATCATCACTGTCATCTTCTTCACCGTCTTTGTGCAGGGCATGACCATTCGGCCCCTGGTAGACCTGTTGGCTGTGAAGAAAAAGCAAGAGACGAAGCGCTCCATCAACGAAGAGATCCACACACAGTTCCTGGACCACCTTCTGACAGGCATCGAAGACATCTGTGGCCACTACGGTCACCACCACTGGAAGGACAAGCTCAACCGGTTTAATAAGAAATATGTGAAGAAGTGTCTGATAGCTGGCGAGCGCTCCAAGGAGCCCCAGCTCATTGCCTTCTACCACAAGATGGAGATGAAGCAGGCCATCGAGCTGGTGGAGAGCGGGGGCATGGGCAAGATCCCCTCTGCCGTCTCCACCGTCTCCATGCAGAACATCCACCCCAAGTCCCTGCCTTCCGAGCGCATCCTGCCAGCACTGTCCAAGGACAAGGAGGAGGAGATCCGCAAAATCCTGAGGAACAACTTGCAGAAGACCAGGCAGCGGCTGCGGTCCTACAACAGACACACGCTGGTGGCAGACCCCTACGAGGAAGCCTGGAACCAGATGCTGCTCCGGAGGCAGAAGGCCCGGCAGCTGGAGCAGAAGATCAACAACTACCTGACGGTGCCAGCCCACAAGCTGGACTCACCCACCATGTCTCGGGCCCGCATCGGCTCAGACCCACTGGCCTATGAGCCGAAGGAGGACCTGCCTGTCATCACCATCGACCCGGCTTCCCCGCAGTCACCCGAGTCTGTGGACCTGGTGAATGAAGAGCTGAAGGGCAAAGTCTTAGGGTTGAGCCGGGATCCTGCAAAGGTGGCTGAGGAGGACGAGGACGACGATGGGGGCATCATGATGCGGAGCAAGGAGACTTCGTCCCCAGGAACCGACGATGTCTTCACCCCCGCGCCCAGTGACAGCCCCAGCTCCCAGAGGATACAGCGCTGCCTCAGTGACCCAGGCCCACACCCTGAGCCTGGGGAGGGAGAACCGTTCTTCCCCAAGGGGCAGTAA

Back to List