Details for gene: VWA3B


cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; nucleoplasm : That part of the nuclear content other than the chromosomes or the nucleolus. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ;


Symbol
VWA3B
Name
von Willebrand factor A domain containing 3B
Entrez ID
200403
Ensembl ID
ENSG00000168658    (more details)
KEGG ID
hsa:200403    (more details)
OMIM ID
614884
Uniprot ID
B7Z3D8  
GO ID
hsa:200403    (more details)
Chromosome
2
Strand
1
Start
98087116
End
98313299
miRNA Interactions
hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-769-5p (RPM: 505.4938) /
Involved Diseases
Posterior capsule opacification (PCO) /
Involved Pathways
Sequence
ATGGAGAAATCAGGCCCATCTTCTACCATCTCTGAGCAGCAGCTGCAGAGGCAAGAGGGATGGATTAACACCAAAACAGACTTGGCTGAGCAGAGTCTCATTTCATCTGAGAAATGGCTTCAACTGCATGGGCTTAAGAGCAACAAATTGACCTTGAAACAGATTTTGTCACAGATCGGATTCCCACATTGTGAAGATTATGTGGCGTCTCTGGGGAGACCTGTGGCTTCTCGGTATGCTGATGGTCTGTTTCCACAGCTCTACAGAGCAGAAGATGGCAGAGTATACAATCTGACAGCTAAATCAGAACTGATTTATCAGTTTGTGGAACATTTAACACAAGCTGTGGAGAGCTACAAGCAGCGAATGGACTGGCTCACCAGCAAGAGCCGGCAGATTTTTGGTGTCATCTTGGAACAGTGCGTCACCATAGTGCTGGATTTTGGCGGCATTCTGGAGGGGGAGCTTGATCTGTGCCGAGAGGCTCTAACAATGGTTCTCCAGGAGCAGGTGGCTCACATAACCGAGTTCAATATCATACGGGTTTCTCAAGAGCCTGTGAAGTGGCAGGAAAATGCTACTCCTGTGACCGAACAGTCCATAGCTACTGCCATCAGTTGGGTTGAGAAACTGACGGTTGAGCTGACTGTGAGCGAGGCTGGCCGCCTGGATGCTCTGCTGGAAGCCGGGAGAGACAAGACTATTGAATCCATTTACTACTTTGTGGTGGGGGATGTTCCTGAAGAATCCAAGGAGCTTCTCCTCCAGAGGGCCTTGGAGATCCCGTGTCCAGTCTACACAGTGTCCTTCAACGCCAGAGGAGAAGGCACTATAGCTTTTCTAAAGGATCTGAGTGCCAAGACCCACAGCAGATTCCACGCATTTGCCGAGAGAACAGAGTGTGTAGAATTTCCTGCATTCTCCACAAAGGATGGTGACAATGTGATGACTTGGAATTCAAGGAAACTGAAAGGAAAACTCCCTCCAGGAGCTGGAGTCAGAGAGGACGTGTTTCTCGTTTGGCAAGAGATGGAGGAAGCCTGCAGCACGCTGGCCCAGATCCAGAGGCTGGTGGCCGAGCCTCCCAAGCCCGACGTGGCCACTGTGGACTGCGAGTCAGAAACAACCTCTGTTGAGATTGCATCGAATCCAGAAGACACCTGGGACTCTAAGACATGGCTGCAGAAATATGGCTTGAAGGCCCAGAAGCTATCCTTGTATGATGTGCTTGCCGACTGCTCTTTCCGCCACGCTGATGGGGTTGTGGATATAAAAGCCAAACCGGAGAATGAGTCCGTGCAGACCAGTGCGGAGACGAACAAGAAGACAGTCCATGCAAAATATTGCAGCAGGTTTGTCCATGCTCCCTGGAAGGATGGGAGCTTGGTCCACGTCAACATTACCAAAGAGAAGTGCAAGTGGTACAGTGAGAGAATCCACACAGCCCTGGCCCGGATCCGAAGGAGGATTAAATGGCTACAGGATGGGAGTCAAAGCCTCTTTGGAAGATTGCATAATGATTGCATCTACATTCTCATTGACACGTCTCACTCAATGAAGAGCAAACTGGACTTGGTGAAGGACAAGATCATTCAGTTCATACAGGAACAGCTGAAATATAAAAGTAAGTTTAACTTTGTGAAGTTTGATGGTCAAGCAGTTGCTTGGCGGGAACAACTTGCTGAAGTCAATGAAGATAATTTGGAACAGGCTCAGTCCTGGATTAGAGACATAAAGATTGGAAGCTCCACAAACACCCTGAGTGCCCTGAAAACTGCTTTTGCTGATAAAGAAACACAGGCAATCTACCTTCTGACCGATGGGAGACCTGATCAGCCACCTGAAACAGTTATAGACCAGGTCAAACGTTTTCAGGAAATTCCTATTTATACCATCTCCTTCAATTACAATGATGAGATTGCAAACAGGTTTTTGAAAGAGGTTGCTGCTTTGACTGGAGGAGAGTTCCATTTTTATAATTTTGGTTGCAAGGATCCCACTCCCCCAGAGGCTGTTCAGAATGAAGATCTGACTCTTTTAGTTAAGGAAATGGAACAGGGTCACAGTGATCTGGAGAAGATGCAAGACCTTTATTCTGAGTCCTTGATCATGGACTGGTGGTACAATGCAGAAAAGGATGGAGACAGCAAGCATCAAAAGGAAATCTGTTCTATGATTTCAACCCCAGAAAAGTGTGCAAAGCCTCAATCTGATGTCGATTCAACACAAACTTCATCTCTGAATATGTTGAAGGGACCATGGGGCCTTTCAGATCAAAAGGTTCAGAAAAAGAAAGTCCTTCACGCAGAATCAACCAAAACCAGCCTGCTCAGAAGCCAGATGTCCTCCCTCAGGAGCTCAGCTTGCAGTGAAAGGAAGGATGGCCTCTCCAATGCCAGCAGCCGGAGGACTGCTCTAAGTGACAAAGAAATGAGCATCTTGCTGGCTGAGGAGTGGCTGGATGACAAATCGTCAGAAAAGGTGACGCGAGAAGGAAGCCAGGTTTATGACCACGATTCTTCAGATGTGTCTTCAGAAAACTGGCTGAAGACCTATGGCTTGGTCGCCAAGAAACTCACCCTCATGGATGCCTTGTCAGTGGCAGCAGTCCCGCACAGCTCCACCTATGTTCCCGTCCTGGACAAGCATGTCGTGTCTAAGGTCTTTGATGAGGTGTTCCCTCTGGCACATGTGTGCAACGACACAAATAAGATGACATTAATTAACCCCCAAGGAGCCAAACTCAATATCTACAAGCGAAAAGTGGAACAGGCAATTCAATCCTATGAAAAGCGCTTGAATAAAATTGTTTGGCGAGCATTATCTCAAGAGGAAAAAGAAAAGTTAGATGCAAACAAACCAATACAGTACTTGGAAAACAAAACAGTTTTAAACCAGGCTTTAGAACGGTTGAATTGGCCCATTTCACTGAAAGAGCTGTCGATGCTGGAAAGTGAAATCCTAGCTGGGAAAATGTACATCCAGCAGGCCATGGAACTCCAGGAGGCTGCCAAGAAGAATTATGCAAACAAGGCCCCGGGAGAGCAACAGAAATTGCAAGGAAATCCAACAAAGAAAACCAAATCAAAAAGACCAGATCCCCTCAAAGGACAGAAGGTTATTGCAAGATGTGATGAAAATGGCTTTTATTTTCCAGGGGTTGTGAAGAAGTGTGTGAGCCGCACCCAAGCACTGGTGGGCTTCAGTTACGGAGACACCAAGGTCGTGTCCACCTCCTTCATCACGCCTGTGGGGGGCGCCATGCCCTGCCCGCTGCTCCAGGTTGGAGATTATGTGTTTGCCAAAATTGTGATACCCAAAGGATTTGACTTCTATGTCCCTGCCATTGTCATAGCACTTCCCAATAAGCATGTGGCCACAGAAAAATTCTACACAGTTTTGAAGTGTAACAACCGGAGAGAATTTTGCCCTCGGAGTGCACTTATTAAGATCAGCCAAAACAAGTATGCGCTCTCTTGCTCTCATATAAAGTCACCCCCAATTCCTGAGGATCCAGAAGTAGAGGATGTGGAGGCGAGGAACTCTGCTTTCCTCTTCTGGCCACTGAAAGAAGCGGACACGCAGGATTCCAGAGAGCCAAGACGAGAGAAGCCCAGGAGGAAAAAGAGGCCCGCCAAGCAGCCACTCCAGCAGGCGGCGCCCTCGGACTCGGACGGCTCCTCCCACGGCATCAGCTCCCATGGGTCCTGCCAGGGGACACACCCCGAGCCCAGGACAGCCCACCTCCACTTCCCCGCGGCCGGGCGTCTAGGACTCAGCAGCCACGCCATCATTGCCACACCTCCACCTCGAGCAGCCCTGCCCTGTACTCTCCAAGCCACCCACAGCAGCAAAGGGCTGAGGAGCGTCCCTGAGACACTTTAA

Back to List