Details for gene: ATG5


cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; autophagy : The cellular catabolic process in which cells digest parts of their own cytoplasm; allows for both recycling of macromolecular constituents under conditions of cellular stress and remodeling the intracellular structure for cell differentiation. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; phagophore assembly site membrane : A cellular membrane associated with the phagophore assembly site. ; macroautophagy : The major inducible pathway for the general turnover of cytoplasmic constituents in eukaryotic cells, it is also responsible for the degradation of active cytoplasmic enzymes and organelles during nutrient starvation. Macroautophagy involves the formation of double-membrane-bounded autophagosomes which enclose the cytoplasmic constituent targeted for degradation in a membrane-bounded structure. Autophagosomes then fuse with a lysosome (or vacuole) releasing single-membrane-bounded autophagic bodies that are then degraded within the lysosome (or vacuole). Some types of macroautophagy, e.g. pexophagy, mitophagy, involve selective targeting of the targets to be degraded. ; apoptotic process : A programmed cell death process which begins when a cell receives an internal (e.g. DNA damage) or external signal (e.g. an extracellular death ligand), and proceeds through a series of biochemical events (signaling pathway phase) which trigger an execution phase. The execution phase is the last step of an apoptotic process, and is typically characterized by rounding-up of the cell, retraction of pseudopodes, reduction of cellular volume (pyknosis), chromatin condensation, nuclear fragmentation (karyorrhexis), plasma membrane blebbing and fragmentation of the cell into apoptotic bodies. When the execution phase is completed, the cell has died. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; autophagosome assembly : The formation of a double membrane-bounded structure, the autophagosome, that occurs when a specialized membrane sac, called the isolation membrane, starts to enclose a portion of the cytoplasm. ; immune system process : Any process involved in the development or functioning of the immune system, an organismal system for calibrated responses to potential internal or invasive threats. ; post-translational protein modification : The process of covalently altering one or more amino acids in a protein after the protein has been completely translated and released from the ribosome. ; axoneme : The bundle of microtubules and associated proteins that forms the core of cilia (also called flagella) in eukaryotic cells and is responsible for their movements. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; regulation of cilium assembly : Any process that modulates the frequency, rate or extent of cilium assembly. ; autophagy of mitochondrion : The autophagic process in which mitochondria are delivered to a type of vacuole and degraded in response to changing cellular conditions. ; cellular response to nitrogen starvation : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of deprivation of nitrogen. ; phagocytic vesicle membrane : The lipid bilayer surrounding a phagocytic vesicle. ; negative regulation of cell death : Any process that decreases the rate or frequency of cell death. Cell death is the specific activation or halting of processes within a cell so that its vital functions markedly cease, rather than simply deteriorating gradually over time, which culminates in cell death. ; autophagosome : A double-membrane-bounded compartment that engulfs endogenous cellular material as well as invading microorganisms to target them to the lytic vacuole/lysosome for degradation as part of macroautophagy. ; C-terminal protein lipidation : The covalent attachment of a lipid group to the carboxy-terminus of a protein. ; autophagy of nucleus : A form of autophagy, by which damaged or non-essential parts of the nucleus, or even an entire nucleus is degraded. ; Atg12-Atg5-Atg16 complex : A protein complex required for the expansion of the autophagosomal membrane. In budding yeast, this complex consists of Atg12p, Atg5p and Atg16p. ; aggrephagy : Selective degradation of protein aggregates by macroautophagy. ; blood vessel remodeling : The reorganization or renovation of existing blood vessels. ; regulation of cytokine production involved in immune response : Any process that modulates the frequency, rate, or extent of cytokine production that contributes to an immune response. ; cellular response to starvation : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of deprivation of nourishment. ; response to xenobiotic stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a xenobiotic compound stimulus. Xenobiotic compounds are compounds foreign to living organisms. ; response to fungus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus from a fungus. ; response to iron(II) ion : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an iron(II) ion stimulus. ; antigen processing and presentation of endogenous antigen : The process in which an antigen-presenting cell expresses antigen (peptide or lipid) of endogenous origin on its cell surface in association with an MHC protein complex. ; negative regulation of protein ubiquitination : Any process that stops, prevents, or reduces the frequency, rate or extent of the addition of ubiquitin groups to a protein. ; negative stranded viral RNA replication : A viral genome replication process where the template genome is negative stranded, single stranded RNA ((-)ssRNA). ; vasodilation : An increase in the internal diameter of blood vessels, especially arterioles or capillaries, due to relaxation of smooth muscle cells that line the vessels, and usually resulting in a decrease in blood pressure. ; negative regulation of apoptotic process : Any process that stops, prevents, or reduces the frequency, rate or extent of cell death by apoptotic process. ; negative thymic T cell selection : The process of elimination of immature T cells in the thymus which react strongly with self-antigens. ; otolith development : The process whose specific outcome is the progression of the otolith over time, from its formation to the mature structure. ; negative regulation of phagocytosis : Any process that stops, prevents, or reduces the frequency, rate or extent of phagocytosis. ; regulation of release of sequestered calcium ion into cytosol : Any process that modulates the frequency, rate or extent of the release into the cytosolic compartment of calcium ions sequestered in the endoplasmic reticulum or mitochondria. ; ventricular cardiac muscle cell development : The process whose specific outcome is the progression of a ventricular cardiac muscle cell over time, from its formation to the mature state. Cardiac muscle cells are striated muscle cells that are responsible for heart contraction. The ventricle is the part of the heart that pumps blood out of the organ. ; heart contraction : The multicellular organismal process in which the heart decreases in volume in a characteristic way to propel blood through the body. ; chaperone-mediated autophagy : The autophagy process which begins when chaperones and co-chaperones recognize a target motif and unfold the substrate protein. The proteins are then transported to the lysosome where they are degraded. ; protein lipidation involved in autophagosome assembly : The protein lipidation process by which phosphatidylethanolamine is conjugated to a protein of the ATG8 family, leading to membrane insertion of the protein as a step in autophagosome assembly. ; positive regulation of mucus secretion : Any process that activates or increases the frequency, rate or extent of the regulated release of mucus from a cell or a tissue. ; cellular response to nitrosative stress : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a nitrosative stress stimulus. Nitrosative stress is a state often resulting from exposure to high levels of nitric oxide (NO) or the highly reactive oxidant peroxynitrite, which is produced following interaction of NO with superoxide anions. ; response to fluoride : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a fluoride stimulus. ; regulation of reactive oxygen species metabolic process : Any process that modulates the frequency, rate or extent of reactive oxygen species metabolic process. ; negative regulation of reactive oxygen species metabolic process : Any process that stops, prevents or reduces the frequency, rate or extent of reactive oxygen species metabolic process. ; negative regulation of histone H4-K16 acetylation : Any process that stops, prevents or reduces the frequency, rate or extent of histone H4-K16 acetylation. ; axon : The long process of a neuron that conducts nerve impulses, usually away from the cell body to the terminals and varicosities, which are sites of storage and release of neurotransmitter. ; protein-containing complex : A stable assembly of two or more macromolecules, i.e. proteins, nucleic acids, carbohydrates or lipids, in which at least one component is a protein and the constituent parts function together. ; mitochondria-associated endoplasmic reticulum membrane : A zone of apposition between endoplasmic-reticulum and mitochondrial membranes, structured by bridging complexes. These contact sites are thought to facilitate inter-organelle calcium and phospholipid exchange. ;


Symbol
ATG5
Name
autophagy related 5
Entrez ID
9474
Ensembl ID
ENSG00000057663    (more details)
KEGG ID
hsa:9474    (more details)
OMIM ID
604261
Uniprot ID
A9UGY9  
GO ID
hsa:9474    (more details)
Chromosome
3
Strand
-1
Start
11272309
End
11557665
miRNA Interactions
hsa-miR-30d-5p (RPM: 9562.1366) / hsa-miR-30e-5p (RPM: 2305.0396) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-135b-5p (RPM: 25.9152) / hsa-miR-19b-3p (RPM: 197.0578) / hsa-miR-19a-3p (RPM: 25.4064) / hsa-miR-92a-3p (RPM: 16961.15) / hsa-miR-9-5p (RPM: 3525.806) / hsa-miR-186-5p (RPM: 1645.2832) / hsa-miR-153-3p (RPM: 53.4548) / hsa-miR-429 (RPM: 100.5032) / hsa-miR-32-5p (RPM: 14.5562) / hsa-miR-181a-5p (RPM: 52364.6344) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-224-3p (RPM: 2.0554) / hsa-miR-25-3p (RPM: 1063.0626) / hsa-miR-299-5p (RPM: 2.2688) / hsa-miR-548b-3p (RPM: 0.1786) / hsa-miR-5581-3p (RPM: 0.3204) / hsa-miR-342-3p (RPM: 685.7862) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-377-5p (RPM: 8.4706) / hsa-miR-125a-3p (RPM: 24.5112) / hsa-miR-210-3p (RPM: 361.0562) /
Involved Diseases
Posterior capsule opacification (PCO) /
Involved Pathways
Antigen processing: Ubiquitination & Proteasome degradation /
Sequence
ATGACAGATGACAAAGATGTGCTTCGAGATGTGTGGTTTGGACGAATTCCAACTTGTTTCACGCTATATCAGGATGAGATAACTGAAAGGGAAGCAGAACCATACTATTTGCTTTTGCCAAGAGTAAGTTATTTGACGTTGGTAACTGACAAAGTGAAAAAGCACTTTCAGAAGGTTATGAGACAAGAAGACATTAGTGAGATATGGTTTGAATATGAAGGCACACCACTGAAATGGCATTATCCAATTGGTTTGCTATTTGATCTTCTTGCATCAAGTTCAGCTCTTCCTTGGAACATCACAGTACATTTTAAGAGTTTTCCAGAAAAAGACCTTCTGCACTGTCCATCTAAGGATGCAATTGAAGCTCATTTTATGTCATGTATGAAAGAAGCTGATGCTTTAAAACATAAAAGTCAAGTAATCAATGAAATGCAGAAAAAAGATCACAAGCAACTCTGGATGGGATTGCAAAATGACAGATTTGACCAGTTTTGGGCCATCAATCGGAAACTCATGGAATATCCTGCAGAAGAAAATGGATTTCGTTATATCCCCTTTAGAATATATCAGACAACGACTGAAAGACCTTTCATTCAGAAGCTGTTTCGTCCTGTGGCTGCAGATGGACAGTTGCACACACTAGGAGATCTCCTCAAAGAAGTTTGTCCTTCTGCTATTGATCCTGAAGATGGGGAAAAAAAGAATCAAGTGATGATTCATGGAATTGAGCCAATGTTGGAAACACCTCTGCAGTGGCTGAGTGAACATCTGAGCTACCCGGATAATTTTCTTCATATTAGTATCATCCCACAGCCAACAGATTGA

Back to List