Details for gene: GDAP2


lysosomal membrane : The lipid bilayer surrounding the lysosome and separating its contents from the cell cytoplasm. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; response to retinoic acid : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a retinoic acid stimulus. ;


Symbol
GDAP2
Name
ganglioside induced differentiation associated protein 2
Entrez ID
54834
Ensembl ID
ENSG00000196505    (more details)
KEGG ID
hsa:54834    (more details)
OMIM ID
618128
Uniprot ID
Q9NXN4  
GO ID
hsa:54834    (more details)
Chromosome
1
Strand
-1
Start
52684449
End
52698347
miRNA Interactions
hsa-miR-15a-5p (RPM: 139.425) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-92a-3p (RPM: 16961.15) / hsa-miR-3662 (RPM: 0.0344) / hsa-miR-92b-3p (RPM: 8345.0264) / hsa-miR-4738-3p (RPM: 0.3144) / hsa-let-7f-5p (RPM: 17066.6836) / hsa-miR-200c-3p (RPM: 348.3196) / hsa-miR-200b-3p (RPM: 566.8348) / hsa-miR-889-3p (RPM: 42.0422) / hsa-miR-98-5p (RPM: 1660.0964) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-miR-577 (RPM: 1.8138) / hsa-miR-543 (RPM: 3.6486) / hsa-miR-1276 (RPM: 0.9142) / hsa-miR-190a-5p (RPM: 14.2908) / hsa-miR-3143 (RPM: 0.0024) / hsa-miR-548n (RPM: 0.0924) / hsa-miR-374c-5p (RPM: 0.1192) / hsa-let-7d-5p (RPM: 1078.3154) / hsa-miR-18a-5p (RPM: 3.6074) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-4760-5p (RPM: 0.0082) / hsa-miR-4521 (RPM: 0.5154) / hsa-miR-27b-5p (RPM: 73.6964) / hsa-miR-338-5p (RPM: 16.892) / hsa-miR-1260a (RPM: 220.2948) / hsa-miR-25-3p (RPM: 1063.0626) / hsa-miR-873-3p (RPM: 8.911) / hsa-miR-224-5p (RPM: 33.3102) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-3144-3p (RPM: 0.0084) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-16-1-3p (RPM: 0.0972) / hsa-miR-590-5p (RPM: 0.1536) / hsa-miR-1260b (RPM: 243.165) / hsa-miR-8061 (RPM: 0.014) /
Involved Diseases
Posterior capsule opacification (PCO) /
Involved Pathways
Base excision repair /
Sequence
ATGGATCCCTTAGGTGCACCTTCCCAGTTTGTGGATGTGGATACACTACCAAGCTGGGGTGACTCATGCCAAGATGAATTAAATTCCTCTGATACTACAGCTGAAATATTTCAGGAAGACACTGTTCGATCACCTTTTCTTTATAATAAGGACGTCAATGGAAAAGTGGTTCTTTGGAAAGGAGATGTGGCATTACTGAACTGTACAGCCATTGTGAATACCAGCAATGAAAGTCTCACAGATAAGAATCCTGTGTCAGAAAGTATCTTCATGCTTGCAGGGCCTGATTTGAAGGAAGATCTCCAGAAACTTAAAGGGTGCCGAACAGGTGAAGCAAAATTGACAAAAGGATTCAATCTAGCTGCCCGGTTCATCATTCACACAGTGGGACCTAAATATAAAAGCCGCTATCGCACAGCAGCTGAGAGTTCCCTTTATAGCTGCTACAGAAACGTACTTCAACTAGCAAAAGAGCAGTCAATGTCTTCTGTTGGCTTCTGTGTCATCAATTCTGCAAAACGTGGTTATCCTTTAGAGGATGCAACACACATAGCACTTCGCACTGTAAGAAGATTCCTAGAGATTCATGGGGAAACCATTGAAAAAGTAGTATTTGCTGTCTCTGATCTTGAAGAGGGTACTTACCAAAAGCTGCTACCTCTCTACTTCCCAAGGTCATTAAAAGAGGAGAATCGATCATTGCCCTACCTACCTGCAGATATTGGAAATGCAGAAGGGGAGCCTGTGGTACCTGAACGACAGATTAGAATAAGTGAGAAACCTGGTGCTCCAGAAGATAACCAAGAAGAGGAGGATGAAGGCTTGGGAGTTGATCTCTCTTTCATTGGCTCTCATGCTTTTGCTCGAATGGAAGGAGATATTGACAAGCAAAGAAAACTGATCCTTCAGGGACAATTATCAGAGGCAGCTCTGCAGAAGCAGCATCAAAGAAATTATAATCGCTGGTTATGTCAAGCAAGATCTGAGGATCTGTCTGATATTGCTTCTCTAAAAGCCTTATACCAAACAGGTGTTGATAACTGTGGTCGAACAGTGATGGTGGTAGTTGGAAGAAACATTCCTGTAACATTAATAGATATGGACAAGGCTCTCTTATATTTCATTCATGTAATGGATCACATTGCTGTGAAGGAGTATGTATTAGTGTATTTTCACACCCTGACCAGCGAATACAATCACCTGGACTCCGACTTCCTGAAGAAACTCTACGATGTTGTTGATGTCAAGTACAAGAGGAATTTGAAGGCTGTTTATTTTGTACATCCCACATTTCGTTCAAAGGTGTCAACATGGTTTTTTACCACCTTTTCTGTCTCAGGACTGAAGGACAAAATCCACCATGTGGACAGCCTCCACCAGCTGTTTTCTGCCATATCACCAGAACAGATTGACTTTCCTCCTTTTGTCCTTGAATATGATGCCAGGGAAAACGGGCCTTACTATACATCATATCCCCCATCACCAGATTTGTGA

Back to List