Details for gene: THG1L


magnesium ion binding : Interacting selectively and non-covalently with magnesium (Mg) ions. ; tRNA modification : The covalent alteration of one or more nucleotides within a tRNA molecule to produce a tRNA molecule with a sequence that differs from that coded genetically. ; tRNA guanylyltransferase activity : Catalysis of the posttranscriptional addition of a guanyl residue to the 5' end of a tRNA molecule; observed for His tRNAs. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; nucleotide binding : Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose. ; transferase activity : Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2. ; tRNA processing : The process in which a pre-tRNA molecule is converted to a mature tRNA, ready for addition of an aminoacyl group. ; mitochondrion : A semiautonomous, self replicating organelle that occurs in varying numbers, shapes, and sizes in the cytoplasm of virtually all eukaryotic cells. It is notably the site of tissue respiration. ; regulation of catalytic activity : Any process that modulates the activity of an enzyme. ; mitochondrial outer membrane : The outer, i.e. cytoplasm-facing, lipid bilayer of the mitochondrial envelope. ; GTP binding : Interacting selectively and non-covalently with GTP, guanosine triphosphate. ; guanyl-nucleotide exchange factor activity : Stimulates the exchange of GDP to GTP on a signaling GTPase, changing its conformation to its active form. Guanine nucleotide exchange factors (GEFs) act by stimulating the release of guanosine diphosphate (GDP) to allow binding of guanosine triphosphate (GTP), which is more abundant in the cell under normal cellular physiological conditions. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; nucleotidyltransferase activity : Catalysis of the transfer of a nucleotidyl group to a reactant. ; mitochondrial fusion : Merging of two or more mitochondria within a cell to form a single compartment. ; identical protein binding : Interacting selectively and non-covalently with an identical protein or proteins. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; tRNA 5'-end processing : The process in which the 5' end of a pre-tRNA molecule is converted to that of a mature tRNA. ; response to oxidative stress : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of oxidative stress, a state often resulting from exposure to high levels of reactive oxygen species, e.g. superoxide anions, hydrogen peroxide (H2O2), and hydroxyl radicals. ; protein homotetramerization : The formation of a protein homotetramer, a macromolecular structure consisting of four noncovalently associated identical subunits. ; tRNA binding : Interacting selectively and non-covalently with transfer RNA. ; ATP binding : Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator. ; transferase complex : A protein complex capable of catalyzing the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). ; stress-induced mitochondrial fusion : Merging of two or more mitochondria within a cell to form a single compartment, as a result of a disturbance in cellular homeostasis. ;


Symbol
THG1L
Name
tRNA-histidine guanylyltransferase 1 like
Entrez ID
54974
Ensembl ID
ENSG00000113272    (more details)
KEGG ID
hsa:54974    (more details)
OMIM ID
618800
Uniprot ID
B4E366  
GO ID
hsa:54974    (more details)
Chromosome
1
Strand
1
Start
117863485
End
117929621
miRNA Interactions
hsa-miR-340-5p (RPM: 285.763) / hsa-miR-101-3p (RPM: 3335.0564) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-4775 (RPM: 1.173) / hsa-miR-590-3p (RPM: 4.5954) / hsa-miR-4482-3p (RPM: 0.0842) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-let-7f-5p (RPM: 17066.6836) / hsa-let-7c-5p (RPM: 4028.6728) / hsa-miR-130a-3p (RPM: 723.372) / hsa-let-7i-5p (RPM: 2025.2084) / hsa-miR-98-5p (RPM: 1660.0964) / hsa-let-7e-5p (RPM: 3790.2074) / hsa-let-7g-5p (RPM: 3559.4376) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-miR-497-3p (RPM: 0.4852) / hsa-let-7d-5p (RPM: 1078.3154) / hsa-miR-138-2-3p (RPM: 0.1862) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-4735-5p (RPM: 0.022) / hsa-miR-376a-5p (RPM: 4.9822) / hsa-miR-615-3p (RPM: 0.1424) / hsa-miR-933 (RPM: 0.2104) / hsa-miR-210-3p (RPM: 361.0562) / hsa-let-7i-3p (RPM: 13.1326) /
Involved Diseases
Posterior capsule opacification (PCO) /
Involved Pathways
Sequence
ATGTGGGGCGCCTGTAAAGTTAAGGTTCACGATTCCTTGGCCACCATTTCCATCACTCTGAGACGGTACCTGAGATTGGGGGCGACCATGGCAAAAAGCAAGTTCGAGTACGTGAGGGACTTCGAGGCTGACGACACCTGCCTGGCACACTGCTGGGTGGTAGTGCGGCTGGACGGCCGGAATTTCCATCGGTTTGCTGAGAAGCACAACTTTGCAAAACCCAATGACAGCCGTGCTCTCCAGCTGATGACCAAATGTGCGCAGACTGTGATGGAAGAACTAGAGGATATTGTGATCGCGTATGGACAGAGTGATGAGTACAGCTTTGTGTTCAAGCGGAAAACCAATTGGTTTAAAAGAAGAGCCAGTAAGTTCATGACTCACGTGGCCTCCCAGTTTGCCTCCAGCTATGTGTTTTATTGGCGGGATTACTTTGAGGACCAGCCCCTTCTGTATCCCCCAGGCTTTGACGGAAGAGTCGTGGTGTATCCCAGCAACCAGACTTTAAAGGACTACCTCAGCTGGCGACAAGCAGATTGTCACATCAATAATCTTTATAATACAGTTTTCTGGGCACTTATACAACAATCTGGACTAACACCAGTACAAGCCCAAGGGAGATTACAGGGAACTCTTGCAGCAGACAAGAATGAGATTTTGTTTTCTGAATTCAACATCAACTATAATAATGAGCTGCCGATGTATAGGAAAGGGACTGTGTTGATATGGCAGAAGGTGGATGAAGTGATGACAAAAGAAATTAAGCTGCCAACAGAAATGGAAGGAAAAAAGATGGCAGTGACCCGGACCAGGACAAAGCCAGTGCCCTTGCACTGCGATATCATCGGGGATGCTTTCTGGAAGGAACATCCAGAGATTCTAGATGAAGACAGCTGA

Back to List