Details for gene: VPS41


protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; intracellular transport : The directed movement of substances within a cell. ; intracellular protein transport : The directed movement of proteins in a cell, including the movement of proteins between specific compartments or structures within a cell, such as organelles of a eukaryotic cell. ; vesicle-mediated transport : A cellular transport process in which transported substances are moved in membrane-bounded vesicles; transported substances are enclosed in the vesicle lumen or located in the vesicle membrane. The process begins with a step that directs a substance to the forming vesicle, and includes vesicle budding and coating. Vesicles are then targeted to, and fuse with, an acceptor membrane. ; protein targeting to vacuole : The process of directing proteins towards the vacuole, usually using signals contained within the protein. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; protein transport : The directed movement of proteins into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; Golgi apparatus : A membrane-bound cytoplasmic organelle of the endomembrane system that further processes the core oligosaccharides (e.g. N-glycans) added to proteins in the endoplasmic reticulum and packages them into membrane-bound vesicles. The Golgi apparatus operates at the intersection of the secretory, lysosomal, and endocytic pathways. ; endosome : A vacuole to which materials ingested by endocytosis are delivered. ; late endosome : A prelysosomal endocytic organelle differentiated from early endosomes by lower lumenal pH and different protein composition. Late endosomes are more spherical than early endosomes and are mostly juxtanuclear, being concentrated near the microtubule organizing center. ; lysosomal membrane : The lipid bilayer surrounding the lysosome and separating its contents from the cell cytoplasm. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; cytoplasmic vesicle : A vesicle found in the cytoplasm of a cell. ; endosome membrane : The lipid bilayer surrounding an endosome. ; autophagy : The cellular catabolic process in which cells digest parts of their own cytoplasm; allows for both recycling of macromolecular constituents under conditions of cellular stress and remodeling the intracellular structure for cell differentiation. ; lysosome : A small lytic vacuole that has cell cycle-independent morphology and is found in most animal cells and that contains a variety of hydrolases, most of which have their maximal activities in the pH range 5-6. The contained enzymes display latency if properly isolated. About 40 different lysosomal hydrolases are known and lysosomes have a great variety of morphologies and functions. ; late endosome membrane : The lipid bilayer surrounding a late endosome. ; early endosome : A membrane-bounded organelle that receives incoming material from primary endocytic vesicles that have been generated by clathrin-dependent and clathrin-independent endocytosis; vesicles fuse with the early endosome to deliver cargo for sorting into recycling or degradation pathways. ; identical protein binding : Interacting selectively and non-covalently with an identical protein or proteins. ; clathrin-coated vesicle : A vesicle with a coat formed of clathrin connected to the membrane via one of the clathrin adaptor complexes. ; HOPS complex : A multimeric protein complex that associates with the vacuolar membrane, late endosomal (multivesicular body) and lysosomal membranes. HOPS is a tethering complex involved in vesicle fusion. ; Golgi-associated vesicle : Any vesicle associated with the Golgi complex and involved in mediating transport within the Golgi or between the Golgi and other parts of the cell. ; AP-3 adaptor complex : A heterotetrameric AP-type membrane coat adaptor complex that consists of beta3, delta, mu3 and sigma3 subunits and is found associated with endosomal membranes. AP-3 does not appear to associate with clathrin in all organisms. In at least humans, the AP-3 complex can be heterogeneric due to the existence of multiple subunit isoforms encoded by different genes (beta3A and beta3B, mu3A and mu3B, and sigma3A and sigma3B). ; molecular_function : A molecular process that can be carried out by the action of a single macromolecular machine, usually via direct physical interactions with other molecular entities. Function in this sense denotes an action, or activity, that a gene product (or a complex) performs. These actions are described from two distinct but related perspectives: (1) biochemical activity, and (2) role as a component in a larger system/process. ; endosome to lysosome transport : The directed movement of substances from endosomes to lysosomes. ; macroautophagy : The major inducible pathway for the general turnover of cytoplasmic constituents in eukaryotic cells, it is also responsible for the degradation of active cytoplasmic enzymes and organelles during nutrient starvation. Macroautophagy involves the formation of double-membrane-bounded autophagosomes which enclose the cytoplasmic constituent targeted for degradation in a membrane-bounded structure. Autophagosomes then fuse with a lysosome (or vacuole) releasing single-membrane-bounded autophagic bodies that are then degraded within the lysosome (or vacuole). Some types of macroautophagy, e.g. pexophagy, mitophagy, involve selective targeting of the targets to be degraded. ; Golgi vesicle transport : The directed movement of substances into, out of or within the Golgi apparatus, mediated by vesicles. ; cellular response to starvation : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of deprivation of nourishment. ; clathrin complex : A protein complex that consists of three clathrin heavy chains and three clathrin light chains, organized into a symmetrical three-legged structure called a triskelion. In clathrin-coated vesicles clathrin is the main component of the coat and forms a polymeric mechanical scaffold on the vesicle surface. ; microtubule binding : Interacting selectively and non-covalently with microtubules, filaments composed of tubulin monomers. ; endosomal vesicle fusion : The homotypic fusion of endocytic vesicles to form or add to an early endosome. ; late endosome to lysosome transport : The directed movement of substances from late endosome to lysosome. ; microtubule cytoskeleton : The part of the cytoskeleton (the internal framework of a cell) composed of microtubules and associated proteins. ; lysosomal HOPS complex : Any HOPS complex that is part of a lysosomal membrane. ; endomembrane system : A collection of membranous structures involved in transport within the cell. The main components of the endomembrane system are endoplasmic reticulum, Golgi bodies, vesicles, cell membrane and nuclear envelope. Members of the endomembrane system pass materials through each other or though the use of vesicles. ;


Symbol
VPS41
Name
VPS41 subunit of HOPS complex
Entrez ID
27072
Ensembl ID
ENSG00000006715    (more details)
KEGG ID
hsa:27072    (more details)
OMIM ID
605485
Uniprot ID
P49754  
GO ID
hsa:27072    (more details)
Chromosome
10
Strand
-1
Start
3137728
End
3172841
miRNA Interactions
hsa-miR-30c-5p (RPM: 3890.0396) / hsa-miR-30d-5p (RPM: 9562.1366) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-30e-5p (RPM: 2305.0396) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-126-5p (RPM: 3089.0568) / hsa-miR-30b-5p (RPM: 1466.5144) / hsa-miR-92a-3p (RPM: 16961.15) / hsa-miR-503-5p (RPM: 0.0972) / hsa-miR-92b-3p (RPM: 8345.0264) / hsa-miR-148a-3p (RPM: 10339.6222) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-494-3p (RPM: 1.1806) / hsa-miR-21-5p (RPM: 5494.851) / hsa-let-7d-5p (RPM: 1078.3154) / hsa-miR-589-3p (RPM: 1.3938) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-873-5p (RPM: 18.2502) / hsa-miR-197-3p (RPM: 347.3274) / hsa-miR-4695-3p (RPM: 0.0182) / hsa-miR-25-3p (RPM: 1063.0626) / hsa-miR-556-3p (RPM: 0.5384) / hsa-miR-556-5p (RPM: 0.386) / hsa-miR-224-5p (RPM: 33.3102) / hsa-miR-505-3p (RPM: 14.5424) / hsa-miR-96-3p (RPM: 0.9616) / hsa-miR-363-3p (RPM: 298.497) / hsa-miR-370-3p (RPM: 8.8808) / hsa-miR-4714-3p (RPM: 0.0838) / hsa-miR-1234-3p (RPM: 0.3324) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-10b-5p (RPM: 14052.6542) / hsa-miR-191-5p (RPM: 12993.8088) / hsa-miR-652-3p (RPM: 178.199) / hsa-miR-6787-3p (RPM: 0.1544) / hsa-miR-6736-3p (RPM: 0.0064) / hsa-miR-4634 (RPM: 0.0048) / hsa-miR-6511b-3p (RPM: 8.2766) / hsa-miR-6511a-3p (RPM: 7.8344) /
Involved Diseases
Posterior capsule opacification (PCO) /
Involved Pathways
tRNA modification in the nucleus and cytosol /
Sequence
ATGGCGGAAGCAGAGGAGCAGGAAACTGGGTCCCTTGAAGAATCTACAGATGAGTCTGAGGAAGAAGAGAGCGAAGAGGAACCCAAGCTGAAGTATGAAAGGCTTTCCAATGGGGTAACTGAAATACTTCAGAAGGATGCAGCTAGCTGCATGACAGTCCATGACAAGTTTTTGGCATTGGGCACACATTATGGCAAGGTTTATTTACTTGATGTCCAGGGGAACATCACTCAGAAGTTTGATGTAAGTCCTGTGAAGATAAATCAGATTAGCTTGGATGAAAGTGGAGAGCACATGGGTGTGTGTTCAGAGGATGGCAAGGTGCAGGTATTTGGACTGTATTCTGGAGAAGAATTTCACGAGACTTTTGACTGTCCCATTAAAATTATTGCTGTGCACCCACATTTCGTGAGATCCAGTTGCAAGCAGTTTGTGACCGGAGGGAAGAAGCTGCTACTGTTTGAACGGTCTTGGATGAACAGATGGAAGTCTGCTGTTCTGCATGAAGGGGAAGGGAACATAAGGAGTGTGAAGTGGAGAGGCCATCTGATTGCTTGGGCCAATAATATGGGTGTGAAGATTTTTGACATCATCTCAAAGCAAAGAATCACCAATGTGCCCCGGGATGATATAAGTCTTCGCCCAGACATGTATCCCTGCAGCCTCTGCTGGAAGGACAATGTGACACTGATTATTGGCTGGGGGACTTCTGTCAAGGTGTGCTCAGTGAAGGAACGGCATGCCAGTGAAATGAGGGATTTGCCAAGTCGATATGTTGAAATAGTGTCTCAGTTTGAAACTGAATTCTACATCAGTGGACTTGCACCTCTCTGTGATCAGCTTGTTGTACTTTCGTATGTAAAGGAGATTTCAGAAAAAACGGAAAGAGAATACTGTGCCAGGCCTAGACTGGACATCATCCAGCCACTTTCTGAGACTTGTGAAGAGATCTCTTCTGATGCTTTGACAGTCAGAGGCTTTCAGGAGAATGAATGTAGAGATTATCATTTAGAATACTCTGAAGGGGAATCACTTTTTTACATCGTGAGTCCGAGAGATGTTGTAGTGGCCAAGGAACGAGACCAAGATGATCACATTGACTGGCTCCTTGAAAAGAAGAAATATGAAGAAGCATTGATGGCAGCTGAAATTAGCCAAAAAAATATTAAAAGACATAAGATTCTGGATATTGGCTTGGCATATATAAATCACCTGGTGGAGAGAGGAGACTATGACATAGCAGCACGCAAATGCCAGAAAATTCTTGGGAAAAATGCAGCACTCTGGGAATATGAAGTTTATAAATTTAAAGAAATTGGACAGCTTAAGGCTATTAGTCCTTATTTGCCAAGAGGTGATCCAGTTCTGAAACCACTCATCTATGAAATGATCTTACATGAATTTTTGGAGAGTGATTATGAGGGTTTTGCCACATTGATCCGAGAATGGCCTGGAGATCTGTATAATAATTCAGTCATAGTTCAAGCAGTTCGGGATCATTTGAAGAAAGATAGTCAGAACAAGACTTTACTTAAAACCCTGGCAGAATTGTACACCTATGACAAGAACTATGGCAATGCTCTGGAAATATACTTAACATTAAGACATAAAGACGTTTTTCAGTTGATCCACAAGCATAATCTTTTCAGTTCTATCAAGGATAAAATTGTTTTATTAATGGATTTTGATTCAGAGAAAGCTGTTGACATGCTTTTGGACAATGAAGATAAAATTTCAATTAAAAAGGTAGTGGAAGAATTGGAAGACAGACCAGAGCTACAGCATGTGTATTTGCATAAGCTTTTCAAGAGAGACCACCATAAGGGGCAGCGTTACCATGAAAAACAGATCAGTCTTTATGCTGAATATGATCGACCAAACTTACTTCCCTTTCTCCGAGACAGTACCCATTGCCCACTTGAAAAGGCTCTTGAGATCTGTCAACAGAGAAACTTTGTAGAAGAGACAGTTTATCTTCTGAGCCGAATGGGTAATAGCCGAAGTGCCCTGAAGATGATTATGGAGGAATTACATGATGTTGATAAAGCAATCGAATTTGCCAAGGAGCAAGATGATGGAGAGCTGTGGGAAGATTTGATTTTATATTCCATTGACAAACCACCATTTATTACTGGCTTGTTAAACAACATTGGCACACATGTTGACCCAATTCTACTGATTCACCGTATTAAGGAAGGAATGGAGATCCCCAATTTGAGAGATTCCTTGGTTAAAATTCTGCAAGACTACAATTTGCAAATTCTGCTTCGTGAAGGCTGCAAGAAGATTCTCGTAGCTGACTCTTTGTCCTTACTGAAGAAAATGCACCGAACTCAAATGAAAGGTGTTCTTGTTGATGAGGAGAACATCTGTGAGTCGTGCCTTTCCCCTATTCTTCCATCAGATGCAGCTAAGCCCTTCAGCGTGGTGGTCTTCCATTGCCGGCACATGTTCCACAAGGAGTGCCTGCCCATGCCCAGCATGAACTCTGCTGCACAGTTCTGCAACATCTGCAGTGCTAAGAACCGTGGACCAGGAAGTGCAATTTTGGAGATGAAAAAATAG

Back to List