Details for gene: PITRM1


metal ion binding : Interacting selectively and non-covalently with any metal ion. ; proteolysis : The hydrolysis of proteins into smaller polypeptides and/or amino acids by cleavage of their peptide bonds. ; mitochondrion : A semiautonomous, self replicating organelle that occurs in varying numbers, shapes, and sizes in the cytoplasm of virtually all eukaryotic cells. It is notably the site of tissue respiration. ; peptidase activity : Catalysis of the hydrolysis of a peptide bond. A peptide bond is a covalent bond formed when the carbon atom from the carboxyl group of one amino acid shares electrons with the nitrogen atom from the amino group of a second amino acid. ; hydrolase activity : Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3. ; zinc ion binding : Interacting selectively and non-covalently with zinc (Zn) ions. ; mitochondrial matrix : The gel-like material, with considerable fine structure, that lies in the matrix space, or lumen, of a mitochondrion. It contains the enzymes of the tricarboxylic acid cycle and, in some organisms, the enzymes concerned with fatty acid oxidation. ; regulation of catalytic activity : Any process that modulates the activity of an enzyme. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; metallopeptidase activity : Catalysis of the hydrolysis of peptide bonds by a mechanism in which water acts as a nucleophile, one or two metal ions hold the water molecule in place, and charged amino acid side chains are ligands for the metal ions. ; metalloendopeptidase activity : Catalysis of the hydrolysis of internal, alpha-peptide bonds in a polypeptide chain by a mechanism in which water acts as a nucleophile, one or two metal ions hold the water molecule in place, and charged amino acid side chains are ligands for the metal ions. ; enzyme activator activity : Binds to and increases the activity of an enzyme. ; protein processing : Any protein maturation process achieved by the cleavage of a peptide bond or bonds within a protein. Protein maturation is the process leading to the attainment of the full functional capacity of a protein. ; protein targeting to mitochondrion : The process of directing proteins towards and into the mitochondrion, usually mediated by mitochondrial proteins that recognize signals contained within the imported protein. ;


Symbol
PITRM1
Name
pitrilysin metallopeptidase 1
Entrez ID
10531
Ensembl ID
ENSG00000107959    (more details)
KEGG ID
hsa:10531    (more details)
OMIM ID
618211
Uniprot ID
Q5JRX3  
GO ID
hsa:10531    (more details)
Chromosome
6
Strand
-1
Start
42696598
End
42722597
miRNA Interactions
hsa-miR-30c-5p (RPM: 3890.0396) / hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-30d-5p (RPM: 9562.1366) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-30e-5p (RPM: 2305.0396) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-1303 (RPM: 5.3758) / hsa-miR-30b-5p (RPM: 1466.5144) / hsa-miR-92a-3p (RPM: 16961.15) / hsa-miR-130a-3p (RPM: 723.372) / hsa-miR-23b-5p (RPM: 1.333) / hsa-miR-5010-3p (RPM: 1.8422) / hsa-miR-21-3p (RPM: 238.3548) / hsa-miR-193b-3p (RPM: 184.968) / hsa-miR-320b (RPM: 35.0146) / hsa-miR-320c (RPM: 5.4174) / hsa-miR-320d (RPM: 3.9486) / hsa-miR-1299 (RPM: 7.6252) / hsa-miR-376a-5p (RPM: 4.9822) / hsa-miR-31-5p (RPM: 310.1326) / hsa-miR-17-3p (RPM: 13.6088) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-28-5p (RPM: 190.0872) / hsa-miR-93-3p (RPM: 9.5402) / hsa-miR-502-3p (RPM: 26.4154) / hsa-miR-17-5p (RPM: 83.6404) / hsa-miR-20b-5p (RPM: 24.4036) / hsa-miR-218-5p (RPM: 36.775) / hsa-miR-191-5p (RPM: 12993.8088) / hsa-miR-151a-3p (RPM: 2381.562) /
Involved Diseases
Posterior capsule opacification (PCO) /
Involved Pathways
Sequence
ATGTGGCGCTGCGGCGGGCGGCAGGGCCTGTGTGTGCTGAGGCGGCTGAGCGGCGGACATGCACACCACAGAGCGTGGCGATGGAACAGTAACCGGGCTTGTGAGAGGGCTCTGCAGTATAAACTAGGAGACAAGATCCATGGATTCACCGTAAACCAGGTGACATCTGTTCCCGAGCTGTTCCTGACTGCAGTGAAGCTCACCCATGATGACACAGGAGCCAGGTATTTACACCTGGCCAGAGAAGACACGAATAATCTGTTCAGCGTGCAGTTCCGTACTACTCCCATGGACAGTACTGGTGTTCCTCACATTCTTGAGCATACCGTCCTTTGTGGGTCTCAGAAATATCCGTGCAGAGACCCTTTCTTCAAAATGTTGAACCGGTCCCTCTCCACGTTCATGAACGCCTTCACAGCTAGTGATTATACTCTGTATCCATTTTCCACACAAAATCCCAAGGACTTTCAGAATCTCCTCTCGGTGTATTTGGATGCCACCTTTTTCCCATGTTTACGCGAGCTGGATTTCTGGCAGGAAGGATGGCGGCTGGAACATGAGAATCCGAGCGACCCCCAGACGCCCTTGGTCTTTAAAGGAGTCGTCTTTAATGAGATGAAGGGAGCGTTTACAGACAATGAGAGGATATTCTCCCAGCACCTTCAGAACAGACTTCTTCCTGACCACACGTACTCAGTGGTCTCCGGGGGTGACCCACTGTGCATCCCGGAGCTTACATGGGAGCAGCTTAAGCAGTTTCATGCCACTCACTATCACCCAAGCAATGCTAGGTTCTTCACGTACGGTAATTTTCCATTAGAACAGCATCTGAAACAAATTCACGAGGAAGCACTGAGCAAATTCCAGAAAATTGAACCAAGCACCGTGGTGCCAGCTCAGACACCCTGGGACAAGCCTAGGGAATTCCAGATAACATGTGGCCCGGATTCATTTGCTACAGATCCCTCTAAACAAACAACCATCAGCGTTAGCTTCCTCTTACCGGACATCACCGACACATTTGAAGCCTTCACATTAAGTCTTCTGTCTTCACTCTTGACTTCTGGGCCCAATTCTCCCTTTTACAAAGCCTTGATTGAATCTGGCCTTGGCACAGACTTTTCTCCTGATGTTGGATATAATGGCTACACGAGGGAGGCCTACTTTAGTGTCGGCCTCCAAGGGATTGCGGAGAAAGACATTGAGACCGTCAGAAGCCTCATAGACAGAACGATTGATGAAGTAGTTGAGAAAGGATTTGAAGATGATCGAATTGAGGCTTTACTTCATAAAATTGAAATACAGATGAAACATCAGTCTACCAGCTTTGGGCTGATGCTGACATCATACATAGCTTCTTGCTGGAACCATGATGGGGACCCTGTGGAGCTCTTGAAGTTGGGAAATCAGTTAGCTAAATTCAGACAGTGCCTGCAGGAAAATCCAAAATTTTTGCAAGAAAAAGTAAAACAGTATTTTAAGAATAACCAGCATAAGCTGACTTTATCGATGAGGCCAGATGACAAGTATCACGAGAAGCAGGCACAGGTGGAAGCCACGAAGCTCAAGCAGAAGGTCGAGGCTCTGTCCCCCGGAGACAGGCAGCAGATCTACGAGAAAGGTCTAGAATTACGGAGTCAACAAAGCAAACCTCAAGATGCCTCTTGTCTGCCAGCGTTGAAAGTTTCCGATATTGAACCCACCATACCTGTCACAGAGTTGGACGTGGTCCTGACAGCTGGAGATATCCCTGTTCAGTACTGCGCCCAGCCCACCAATGGCATGGTGTATTTCCGGGCCTTCTCCAGCCTGAACACACTCCCCGAGGAGCTGAGGCCCTATGTGCCCCTCTTCTGCAGCGTCCTCACCAAGCTGGGCTGCGGCCTTCTTGACTACCGGGAGCAGGCTCAGCAGATAGAATTGAAGACCGGAGGGATGAGTGCTTCTCCCCACGTGCTCCCCGACGACTCACACATGGACACCTACGAGCAGGGTGTGCTTTTCTCCTCTCTCTGCCTGGATCGAAACCTGCCAGACATGATGCAGCTATGGAGTGAAATATTTAACAACCCGTGCTTTGAAGAAGAGGAGCACTTCAAGGTGCTGGTGAAGATGACCGCCCAGGAGCTCGCCAATGGAATTCCTGACTCTGGGCACCTGTACGCATCCATCAGGGCAGGCCGGACCCTCACGCCCGCAGGGGACCTGCAGGAGACCTTCAGCGGGATGGATCAGGTGCGGCTGATGAAGAGGATTGCAGAAATGACAGATATCAAACCCATCCTGAGGAAGCTCCCGCGTATCAAGAAACACTTGTTAAATGGTGATAATATGAGGTGTTCAGTGAATGCGACTCCTCAGCAGATGCCTCAGACAGAAAAAGCGGTCGAAGACTTCCTTAGAAGCATCGGTCGGAGTAAAAAGGAACGGAGGCCTGTGCGCCCACACACGGTCGAGAAACCTGTGCCCAGCAGCTCTGGTGGAGATGCCCACGTTCCCCATGGCTCCCAGGTCATTAGGAAGCTGGTCATGGAACCCACCTTCAAGCCCTGGCAGATGAAGACTCACTTCCTGATGCCCTTCCCGGTGAATTACGTGGGTGAATGCATCCGAACTGTCCCCTACACGGACCCAGATCATGCCAGTCTTAAAATCCTTGCACGTTTGATGACTGCCAAATTCTTGCATACAGAAATTCGAGAAAAAGGCGGTGCTTATGGTGGAGGCGCAAAACTCAGCCACAATGGGATTTTCACCCTTTACTCTTACAGGGACCCAAATACAATAGAGACGCTCCAGTCTTTTGGGAAGGCTGTCGACTGGGCTAAGTCTGGAAAATTCACACAGCAAGACATCGACGAAGCCAAACTTTCTGTCTTCTCAACCGTAGATGCTCCTGTCGCTCCTTCAGACAAAGGAATGGACCACTTCTTGTACGGCCTCTCGGATGAGATGAAGCAGGCCCACAGAGAGCAGCTCTTTGCTGTCAGCCACGACAAGCTCCTGGCCGTGAGCGATAGATACCTCGGCACTGGGAAGAGCACACACGGCCTGGCCATCCTCGGACCCGAGAACCCGAAAATTGCCAAGGACCCATCCTGGATCATCCAATGA

Back to List