Details for gene: ATG7


ubiquitin-like modifier activating enzyme activity : Catalysis of the activation of small proteins, such as ubiquitin or ubiquitin-like proteins, through the formation of an ATP-dependent high-energy thiolester bond. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; protein transport : The directed movement of proteins into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; phagophore assembly site : Punctate structures proximal to the endoplasmic reticulum which are the sites where the Atg machinery assembles upon autophagy induction. ; protein homodimerization activity : Interacting selectively and non-covalently with an identical protein to form a homodimer. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; autophagy : The cellular catabolic process in which cells digest parts of their own cytoplasm; allows for both recycling of macromolecular constituents under conditions of cellular stress and remodeling the intracellular structure for cell differentiation. ; rhythmic process : Any process pertinent to the generation and maintenance of rhythms in the physiology of an organism. ; positive regulation of apoptotic process : Any process that activates or increases the frequency, rate or extent of cell death by apoptotic process. ; axoneme : The bundle of microtubules and associated proteins that forms the core of cilia (also called flagella) in eukaryotic cells and is responsible for their movements. ; extracellular region : The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite. ; protein modification by small protein conjugation : A protein modification process in which one or more groups of a small protein, such as ubiquitin or a ubiquitin-like protein, are covalently attached to a target protein. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; autophagosome assembly : The formation of a double membrane-bounded structure, the autophagosome, that occurs when a specialized membrane sac, called the isolation membrane, starts to enclose a portion of the cytoplasm. ; autophagy of mitochondrion : The autophagic process in which mitochondria are delivered to a type of vacuole and degraded in response to changing cellular conditions. ; cellular response to nitrogen starvation : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of deprivation of nitrogen. ; cellular response to starvation : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of deprivation of nourishment. ; positive regulation of protein catabolic process : Any process that activates or increases the frequency, rate or extent of the chemical reactions and pathways resulting in the breakdown of a protein by the destruction of the native, active configuration, with or without the hydrolysis of peptide bonds. ; late nucleophagy : A type of nucleophagy, distinct from piecemeal microautophagy of the nucleus (PNM) where the nuclear material is delivered to the vacuole/lysosome for breakdown and recycling later than observed for PNM. ; secretory granule lumen : The volume enclosed by the membrane of a secretory granule. ; ficolin-1-rich granule lumen : Any membrane-enclosed lumen that is part of a ficolin-1-rich granule. ; transcription factor binding : Interacting selectively and non-covalently with a transcription factor, a protein required to initiate or regulate transcription. ; regulation of circadian rhythm : Any process that modulates the frequency, rate or extent of a circadian rhythm. A circadian rhythm is a biological process in an organism that recurs with a regularity of approximately 24 hours. ; piecemeal microautophagy of the nucleus : Degradation of a cell nucleus by lysosomal microautophagy. ; macroautophagy : The major inducible pathway for the general turnover of cytoplasmic constituents in eukaryotic cells, it is also responsible for the degradation of active cytoplasmic enzymes and organelles during nutrient starvation. Macroautophagy involves the formation of double-membrane-bounded autophagosomes which enclose the cytoplasmic constituent targeted for degradation in a membrane-bounded structure. Autophagosomes then fuse with a lysosome (or vacuole) releasing single-membrane-bounded autophagic bodies that are then degraded within the lysosome (or vacuole). Some types of macroautophagy, e.g. pexophagy, mitophagy, involve selective targeting of the targets to be degraded. ; C-terminal protein lipidation : The covalent attachment of a lipid group to the carboxy-terminus of a protein. ; protein lipidation : The covalent attachment of lipid groups to an amino acid in a protein. ; positive regulation of protein modification process : Any process that activates or increases the frequency, rate or extent of the covalent alteration of one or more amino acid residues within a protein. ; Atg12 activating enzyme activity : Catalysis of the activation of the small ubiquitin-related modifier APG12, through the formation of an ATP-dependent high-energy thiolester bond. ; Atg8 activating enzyme activity : Catalysis of the activation of the small ubiquitin-related modifier APG8, through the formation of an ATP-dependent high-energy thiolester bond. ; suppression by virus of host autophagy : Any process in which a virus stops, prevents, or reduces the frequency, rate or extent of autophagy in the host. ; defense response to virus : Reactions triggered in response to the presence of a virus that act to protect the cell or organism. ; cellular response to hyperoxia : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating increased oxygen tension. ;


Symbol
ATG7
Name
autophagy related 7
Entrez ID
10533
Ensembl ID
ENSG00000197548    (more details)
KEGG ID
hsa:10533    (more details)
OMIM ID
608760
Uniprot ID
O95352  
GO ID
hsa:10533    (more details)
Chromosome
14
Strand
1
Start
89954939
End
90044764
miRNA Interactions
hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-106a-5p (RPM: 7.9736) / hsa-miR-96-5p (RPM: 1417.2834) / hsa-miR-3922-5p (RPM: 0.0154) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-589-5p (RPM: 54.2348) / hsa-miR-3127-5p (RPM: 1.7222) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-4685-5p (RPM: 0.0078) / hsa-let-7a-3p (RPM: 33.7298) / hsa-miR-4753-5p (RPM: 0.097) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-193b-3p (RPM: 184.968) / hsa-miR-4733-3p (RPM: 0.063) / hsa-miR-320c (RPM: 5.4174) / hsa-miR-142-3p (RPM: 8.3404) / hsa-miR-1266-5p (RPM: 1.282) / hsa-miR-154-5p (RPM: 2.6308) / hsa-miR-4726-5p (RPM: 0.184) / hsa-miR-4640-5p (RPM: 0.0282) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-4687-5p (RPM: 1.8196) / hsa-miR-3918 (RPM: 0.7636) / hsa-miR-4708-3p (RPM: 0.357) / hsa-miR-4640-3p (RPM: 0.9382) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-6749-3p (RPM: 0.0746) / hsa-miR-6879-3p (RPM: 0.0316) / hsa-miR-6826-5p (RPM: 0.024) / hsa-miR-6783-5p (RPM: 0.0136) / hsa-miR-6837-5p (RPM: 0.057) / hsa-miR-6802-3p (RPM: 0.4086) / hsa-miR-6753-5p (RPM: 0.0068) / hsa-miR-6895-5p (RPM: 0.3264) /
Involved Diseases
Posterior capsule opacification (PCO) /
Involved Pathways
Sequence
ATGGCGGCAGCTACGGGGGATCCTGGACTCTCTAAACTGCAGTTTGCCCCTTTTAGTAGTGCCTTGGATGTTGGGTTTTGGCATGAGTTGACCCAGAAGAAGCTGAACGAGTATCGGCTGGATGAAGCTCCCAAGGACATTAAGGGTTATTACTACAATGGTGACTCTGCTGGGCTGCCAGCTCGCTTAACATTGGAGTTCAGTGCTTTTGACATGAGTGCTCCCACCCCAGCCCGTTGCTGCCCAGCTATTGGAACACTGTATAACACCAACACACTCGAGTCTTTCAAGACTGCAGATAAGAAGCTCCTTTTGGAACAAGCAGCAAATGAGATATGGGAATCCATAAAATCAGGCACTGCTCTTGAAAACCCTGTACTCCTCAACAAGTTCCTCCTCTTGACATTTGCAGATCTAAAGAAGTACCACTTCTACTATTGGTTTTGCTATCCTGCCCTCTGTCTTCCAGAGAGTTTACCTCTCATTCAGGGGCCAGTGGGTTTGGATCAAAGGTTTTCACTAAAACAGATTGAAGCACTAGAGTGTGCATATGATAATCTTTGTCAAACAGAAGGAGTCACAGCTCTTCCTTACTTCTTAATCAAGTATGATGAGAACATGGTGCTGGTTTCCTTGCTTAAACACTACAGTGATTTCTTCCAAGGTCAAAGGACGAAGATAACAATTGGTGTATATGATCCCTGTAACTTAGCCCAGTACCCTGGATGGCCTTTGAGGAATTTTTTGGTCCTAGCAGCCCACAGATGGAGTAGCAGTTTCCAGTCTGTTGAAGTTGTTTGCTTCCGTGACCGTACCATGCAGGGGGCGAGAGACGTTGCCCACAGCATCATCTTCGAAGTGAAGCTTCCAGAAATGGCATTTAGCCCAGATTGTCCTAAAGCAGTTGGATGGGAAAAGAACCAGAAAGGAGGCATGGGACCAAGGATGGTGAACCTCAGTGAATGTATGGACCCTAAAAGGTTAGCTGAGTCATCAGTGGATCTAAATCTCAAACTGATGTGTTGGAGATTGGTTCCTACTTTAGACTTGGACAAGGTTGTGTCTGTCAAATGTCTGCTGCTTGGAGCCGGCACCTTGGGTTGCAATGTAGCTAGGACGTTGATGGGTTGGGGCGTGAGACACATCACATTTGTGGACAATGCCAAGATCTCCTACTCCAATCCTGTGAGGCAGCCTCTCTATGAGTTTGAAGATTGCCTAGGGGGTGGTAAGCCCAAGGCTCTGGCAGCAGCGGACCGGCTCCAGAAAATATTCCCCGGTGTGAATGCCAGAGGATTCAACATGAGCATACCTATGCCTGGGCATCCAGTGAACTTCTCCAGTGTCACTCTGGAGCAAGCCCGCAGAGATGTGGAGCAACTGGAGCAGCTCATCGAAAGCCATGATGTCGTCTTCCTATTGATGGACACCAGGGAGAGCCGGTGGCTTCCTGCCGTCATTGCTGCAAGCAAGAGAAAGCTGGTCATCAATGCTGCTTTGGGATTTGACACATTTGTTGTCATGAGACATGGTCTGAAGAAACCAAAGCAGCAAGGAGCTGGGGACTTGTGTCCAAACCACCCTGTGGCATCTGCTGACCTCCTGGGCTCATCGCTTTTTGCCAACATCCCTGGTTACAAGCTTGGCTGCTACTTCTGCAATGATGTGGTGGCCCCAGGAGATTCAACCAGAGACCGGACCTTGGACCAGCAGTGCACTGTGAGTCGTCCAGGACTGGCCGTGATTGCAGGAGCCCTGGCCGTGGAATTGATGGTATCTGTTTTGCAGCATCCAGAAGGGGGCTATGCCATTGCCAGCAGCAGTGACGATCGGATGAATGAGCCTCCAACCTCTCTTGGGCTTGTGCCTCACCAGATCCGGGGATTTCTTTCACGGTTTGATAATGTCCTTCCCGTCAGCCTGGCATTTGACAAATGTACAGCTTGTTCTTCCAAAGTTCTTGATCAATATGAACGAGAAGGATTTAACTTCCTAGCCAAGGTGTTTAATTCTTCACATTCCTTCTTAGAAGACTTGACTGGTCTTACATTGCTGCATCAAGAAACCCAAGCTGCTGAGATCTGGGACATGAGCGATGATGAGACCATCTGA

Back to List