Details for gene: PRPH2


integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; cell adhesion : The attachment of a cell, either to another cell or to an underlying substrate such as the extracellular matrix, via cell adhesion molecules. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; photoreceptor inner segment : The inner segment of a vertebrate photoreceptor containing mitochondria, ribosomes and membranes where opsin molecules are assembled and passed to be part of the outer segment discs. ; integral component of plasma membrane : The component of the plasma membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; photoreceptor outer segment : The outer segment of a vertebrate photoreceptor that contains a stack of membrane discs embedded with photoreceptor proteins. ; protein homodimerization activity : Interacting selectively and non-covalently with an identical protein to form a homodimer. ; response to low light intensity stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a low light intensity stimulus. Low light intensity is defined as a level of electromagnetic radiation at or below 0.1 micromols/m2. ; photoreceptor cell outer segment organization : A process that is carried out at the cellular level and results in the assembly, arrangement of constituent parts, or disassembly of the outer segment of a photoreceptor cell, a sensory cell that reacts to the presence of light. The outer segment of the photoreceptor cell contains the light-absorbing materials. ; detection of light stimulus involved in visual perception : The series of events involved in visual perception in which a light stimulus is received and converted into a molecular signal. ; protein homooligomerization : The process of creating protein oligomers, compounds composed of a small number, usually between three and ten, of identical component monomers. Oligomers may be formed by the polymerization of a number of monomers or the depolymerization of a large protein polymer. ; protein heterooligomerization : The process of creating protein oligomers, compounds composed of a small number, usually between three and ten, of component monomers that are not all identical. Oligomers may be formed by the polymerization of a number of monomers or the depolymerization of a large protein polymer. ; retina development in camera-type eye : The process whose specific outcome is the progression of the retina over time, from its formation to the mature structure. The retina is the innermost layer or coating at the back of the eyeball, which is sensitive to light and in which the optic nerve terminates. ;


Symbol
PRPH2
Name
peripherin 2
Entrez ID
5961
Ensembl ID
ENSG00000112619    (more details)
KEGG ID
hsa:5961    (more details)
OMIM ID
136880
Uniprot ID
P23942  
GO ID
hsa:5961    (more details)
Chromosome
7
Strand
-1
Start
38722974
End
38932394
miRNA Interactions
hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-130a-5p (RPM: 1.1956) / hsa-miR-23b-3p (RPM: 2125.0486) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGGCGCTACTGAAAGTCAAGTTTGACCAGAAGAAGCGGGTCAAGTTGGCCCAAGGGCTCTGGCTCATGAACTGGTTCTCCGTGTTGGCTGGCATCATCATCTTCAGCCTAGGACTGTTCCTGAAGATTGAACTCCGAAAGAGGAGCGATGTGATGAATAATTCTGAGAGCCATTTTGTGCCCAACTCATTGATAGGGATGGGGGTGCTATCCTGTGTCTTCAACTCGCTGGCTGGGAAGATCTGCTACGACGCCCTGGACCCAGCCAAGTATGCCAGATGGAAGCCCTGGCTGAAGCCGTACCTGGCTATCTGTGTTCTCTTCAACATCATCCTCTTCCTTGTGGCTCTCTGCTGCTTTCTGCTTCGGGGCTCGCTGGAGAACACCCTGGGCCAAGGGCTCAAGAACGGCATGAAGTACTACCGGGACACAGACACCCCTGGCAGGTGTTTCATGAAGAAGACCATCGACATGCTGCAGATCGAGTTCAAATGCTGCGGCAACAACGGTTTTCGGGACTGGTTTGAGATTCAGTGGATCAGCAATCGCTACCTGGACTTTTCCTCCAAAGAAGTCAAAGATCGAATCAAGAGCAACGTGGATGGGCGGTACCTGGTGGACGGCGTCCCTTTCAGCTGCTGCAATCCTAGCTCGCCACGGCCCTGCATCCAGTATCAGATCACCAACAACTCAGCACACTACAGTTACGACCACCAGACGGAGGAGCTCAACCTGTGGGTGCGTGGCTGCAGGGCTGCCCTGCTGAGCTACTACAGCAGCCTCATGAACTCCATGGGTGTCGTCACGCTCCTCATTTGGCTCTTCGAGGTGACCATTACAATTGGGCTGCGCTACCTACAGACGTCGCTGGATGGTGTGTCCAACCCCGAGGAATCTGAGAGCGAGAGCCAGGGCTGGCTGCTGGAGAGGAGCGTGCCGGAGACCTGGAAGGCCTTTCTGGAGAGTGTGAAGAAGCTGGGCAAGGGCAACCAGGTGGAAGCCGAGGGCGCAGACGCAGGCCAGGCCCCAGAGGCTGGCTGA

Back to List