Details for gene: CLCC1


membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; intracellular membrane-bounded organelle : Organized structure of distinctive morphology and function, bounded by a single or double lipid bilayer membrane and occurring within the cell. Includes the nucleus, mitochondria, plastids, vacuoles, and vesicles. Excludes the plasma membrane. ; endoplasmic reticulum : The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached). ; nuclear membrane : Either of the lipid bilayers that surround the nucleus and form the nuclear envelope; excludes the intermembrane space. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; endoplasmic reticulum membrane : The lipid bilayer surrounding the endoplasmic reticulum. ; ion transport : The directed movement of charged atoms or small charged molecules into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; Golgi apparatus : A membrane-bound cytoplasmic organelle of the endomembrane system that further processes the core oligosaccharides (e.g. N-glycans) added to proteins in the endoplasmic reticulum and packages them into membrane-bound vesicles. The Golgi apparatus operates at the intersection of the secretory, lysosomal, and endocytic pathways. ; Golgi membrane : The lipid bilayer surrounding any of the compartments of the Golgi apparatus. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; chloride channel activity : Enables the facilitated diffusion of a chloride (by an energy-independent process) involving passage through a transmembrane aqueous pore or channel without evidence for a carrier-mediated mechanism. ; chloride transport : The directed movement of chloride into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; chloride channel complex : An ion channel complex through which chloride ions pass. ; mitochondria-associated endoplasmic reticulum membrane : A zone of apposition between endoplasmic-reticulum and mitochondrial membranes, structured by bridging complexes. These contact sites are thought to facilitate inter-organelle calcium and phospholipid exchange. ;


Symbol
CLCC1
Name
chloride channel CLIC like 1
Entrez ID
23155
Ensembl ID
ENSG00000121940    (more details)
KEGG ID
hsa:23155    (more details)
OMIM ID
609913
Uniprot ID
A0A024R0G0  
GO ID
hsa:23155    (more details)
Chromosome
19
Strand
-1
Start
43543311
End
43580473
miRNA Interactions
hsa-miR-30c-5p (RPM: 3890.0396) / hsa-miR-15a-5p (RPM: 139.425) / hsa-miR-3658 (RPM: 0.0008) / hsa-miR-30d-5p (RPM: 9562.1366) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-30e-5p (RPM: 2305.0396) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-126-5p (RPM: 3089.0568) / hsa-miR-1303 (RPM: 5.3758) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-30b-5p (RPM: 1466.5144) / hsa-miR-3926 (RPM: 0.0072) / hsa-miR-590-3p (RPM: 4.5954) / hsa-miR-582-5p (RPM: 8.1398) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-200c-3p (RPM: 348.3196) / hsa-miR-200b-3p (RPM: 566.8348) / hsa-miR-429 (RPM: 100.5032) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-486-5p (RPM: 3314.1068) / hsa-miR-3190-5p (RPM: 0.0008) / hsa-miR-455-3p (RPM: 82.7264) / hsa-miR-548s (RPM: 0.1718) / hsa-miR-323a-3p (RPM: 23.6866) / hsa-miR-876-3p (RPM: 0.2528) / hsa-miR-4728-5p (RPM: 0.1204) / hsa-miR-142-5p (RPM: 245.4844) / hsa-miR-181d-5p (RPM: 168.2728) / hsa-miR-181b-5p (RPM: 3069.8278) / hsa-miR-181c-5p (RPM: 1285.07) / hsa-miR-181a-5p (RPM: 52364.6344) / hsa-miR-5690 (RPM: 1.0164) / hsa-miR-33a-3p (RPM: 1.692) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-302a-5p (RPM: 0.1518) / hsa-miR-136-3p (RPM: 178.2682) / hsa-miR-499a-3p (RPM: 0.2716) / hsa-miR-940 (RPM: 4.614) / hsa-miR-30c-2-3p (RPM: 52.8714) / hsa-miR-4786-5p (RPM: 0.6678) / hsa-miR-30b-3p (RPM: 13.9872) / hsa-miR-3192-5p (RPM: 0.1056) / hsa-miR-149-3p (RPM: 0.3876) / hsa-miR-4435 (RPM: 1.1176) / hsa-miR-3675-3p (RPM: 0.001) / hsa-miR-890 (RPM: 0.1328) / hsa-miR-641 (RPM: 12.2284) / hsa-miR-3929 (RPM: 0.0406) / hsa-miR-485-5p (RPM: 12.0734) / hsa-miR-4768-3p (RPM: 0.002) / hsa-miR-224-5p (RPM: 33.3102) / hsa-miR-30c-1-3p (RPM: 36.5546) / hsa-miR-490-3p (RPM: 5.7068) / hsa-miR-615-3p (RPM: 0.1424) / hsa-miR-769-5p (RPM: 505.4938) / hsa-miR-665 (RPM: 0.445) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-425-5p (RPM: 187.631) / hsa-miR-34b-3p (RPM: 5.6562) / hsa-miR-3614-5p (RPM: 0.263) / hsa-miR-4478 (RPM: 0.0594) / hsa-miR-377-5p (RPM: 8.4706) / hsa-miR-501-5p (RPM: 3.2752) / hsa-miR-4684-5p (RPM: 0.0056) / hsa-miR-4473 (RPM: 0.2418) / hsa-miR-508-3p (RPM: 8.6518) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-10a-5p (RPM: 408.7974) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-6785-5p (RPM: 0.0412) / hsa-miR-6883-5p (RPM: 0.0016) / hsa-miR-6849-3p (RPM: 0.0148) / hsa-miR-7856-5p (RPM: 0.003) / hsa-miR-7106-5p (RPM: 0.007) / hsa-miR-6880-5p (RPM: 0.1286) / hsa-miR-6771-3p (RPM: 0.004) / hsa-miR-887-5p (RPM: 3.285) / hsa-miR-1273h-5p (RPM: 0.1102) / hsa-miR-6780a-5p (RPM: 0.2598) / hsa-miR-6779-5p (RPM: 0.1952) / hsa-miR-6128 (RPM: 0.0022) / hsa-miR-6516-5p (RPM: 0.859) / hsa-miR-6799-5p (RPM: 0.0034) / hsa-miR-7851-3p (RPM: 0.0118) / hsa-miR-6808-5p (RPM: 0.0032) / hsa-miR-6884-5p (RPM: 0.168) / hsa-miR-6893-5p (RPM: 0.0066) / hsa-miR-6500-3p (RPM: 1.2556) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGCTGTGTTCTTTGCTCCTTTGTGAATGTCTGTTGCTGGTAGCTGGTTATGCTCATGATGATGACTGGATTGACCCCACAGACATGCTTAACTATGATGCTGCTTCAGGAACAATGAGAAAATCTCAGGCAAAATATGGTATTTCAGGGGAAAAGGATGTCAGTCCTGACTTGTCATGTGCTGATGAAATATCAGAATGTTATCACAAACTTGATTCTTTAACTTATAAGATTGATGAGTGTGAAAAGAAAAAGAGGGAAGACTATGAAAGTCAAAGCAATCCTGTTTTTAGGAGATACTTAAATAAGATTTTAATTGAAGCTGGAAAGCTTGGACTTCCTGATGAAAACAAAGGCGATATGCATTATGATGCTGAGATTATCCTTAAAAGAGAAACTTTGTTAGAAATACAGAAGTTTCTCAATGGAGAAGACTGGAAACCAGGTGCCTTGGATGATGCACTAAGTGATATTTTAATTAATTTTAAGTTTCATGATTTTGAAACATGGAAGTGGCGATTCGAAGATTCCTTTGGAGTGGATCCATATAATGTGTTAATGGTACTTCTTTGTCTGCTCTGCATCGTGGTTTTAGTGGCTACTGAGCTGTGGACATATGTACGTTGGTACACTCAGTTGAGACGTGTTTTAATCATCAGCTTTCTGTTCAGTTTGGGATGGAATTGGATGTATTTATATAAGCTAGCTTTTGCACAGCATCAGGCTGAAGTCGCCAAGATGGAGCCATTAAACAATGTGTGTGCCAAAAAGATGGACTGGACTGGAAGTATCTGGGAATGGTTTAGAAGTTCATGGACCTATAAGGATGACCCATGCCAAAAATACTATGAGCTCTTACTAGTCAACCCTATTTGGTTGGTCCCACCAACAAAGGCACTTGCAGTTACATTCACCACATTTGTAACGGAGCCATTGAAGCATATTGGAAAAGGAACTGGGGAATTTATTAAAGCACTCATGAAGGAAATTCCAGCGCTGCTTCATCTTCCAGTGCTGATAATTATGGCATTAGCCATCCTGAGTTTCTGCTATGGTGCTGGAAAATCAGTTCATGTGCTGAGACATATAGGCGGTCCTGAGAGCGAACCTCCCCAGGCACTTCGGCCACGGGATAGAAGACGGCAGGAGGAAATTGATTATAGACCTGATGGTGGAGCAGGTGATGCCGATTTCCATTATAGGGGCCAAATGGGCCCCACTGAGCAAGGCCCTTATGCCAAAACGTATGAGGGTAGAAGAGAGATTTTGAGAGAGAGAGATGTTGACTTGAGATTTCAGACTGGCAACAAGAGCCCTGAAGTGCTCCGGGCATTTGATGTACCAGACGCAGAGGCACGAGAGCATCCCACGGTGGTACCCAGTCATAAATCACCTGTTTTGGATACAAAGCCCAAGGAGACAGGTGGAATCCTGGGGGAAGGCACACCGAAAGAAAGCAGTACTGAAAGCAGCCAGTCGGCCAAGCCTGTCTCTGGCCAAGACACATCAGGGAATACAGAAGGTTCACCCGCAGCGGAAAAGGCCCAGCTCAAGTCTGAAGCCGCAGGCAGCCCAGACCAAGGCAGCACATACAGCCCCGCAAGAGGTGTGGCTGGACCACGTGGACAGGATCCGGTCAGCAGCCCCTGTGGCTAG

Back to List