Details for gene: HK1


glycolytic process : The chemical reactions and pathways resulting in the breakdown of a carbohydrate into pyruvate, with the concomitant production of a small amount of ATP and the reduction of NAD(P) to NAD(P)H. Glycolysis begins with the metabolism of a carbohydrate to generate products that can enter the pathway and ends with the production of pyruvate. Pyruvate may be converted to acetyl-coenzyme A, ethanol, lactate, or other small molecules. ; ATP binding : Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator. ; carbohydrate metabolic process : The chemical reactions and pathways involving carbohydrates, any of a group of organic compounds based of the general formula Cx(H2O)y. Includes the formation of carbohydrate derivatives by the addition of a carbohydrate residue to another molecule. ; phosphotransferase activity, alcohol group as acceptor : Catalysis of the transfer of a phosphorus-containing group from one compound (donor) to an alcohol group (acceptor). ; hexokinase activity : Catalysis of the reaction: ATP + D-hexose = ADP + D-hexose 6-phosphate. ; glucose binding : Interacting selectively and non-covalently with the D- or L-enantiomer of glucose. ; cellular glucose homeostasis : A cellular homeostatic process involved in the maintenance of an internal steady state of glucose within a cell or between a cell and its external environment. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; nucleotide binding : Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose. ; kinase activity : Catalysis of the transfer of a phosphate group, usually from ATP, to a substrate molecule. ; transferase activity : Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2. ; phosphorylation : The process of introducing a phosphate group into a molecule, usually with the formation of a phosphoric ester, a phosphoric anhydride or a phosphoric amide. ; cellular process : Any process that is carried out at the cellular level, but not necessarily restricted to a single cell. For example, cell communication occurs among more than one cell, but occurs at the cellular level. ; mitochondrion : A semiautonomous, self replicating organelle that occurs in varying numbers, shapes, and sizes in the cytoplasm of virtually all eukaryotic cells. It is notably the site of tissue respiration. ; mitochondrial outer membrane : The outer, i.e. cytoplasm-facing, lipid bilayer of the mitochondrial envelope. ; glucokinase activity : Catalysis of the reaction: ATP + D-glucose = ADP + D-glucose-6-phosphate. ; hexose metabolic process : The chemical reactions and pathways involving a hexose, any monosaccharide with a chain of six carbon atoms in the molecule. ; carbohydrate phosphorylation : The process of introducing a phosphate group into a carbohydrate, any organic compound based on the general formula Cx(H2O)y. ; glucose 6-phosphate metabolic process : The chemical reactions and pathways involving glucose 6-phosphate, a monophosphorylated derivative of glucose with the phosphate group attached to C-6. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; catalytic activity : Catalysis of a biochemical reaction at physiological temperatures. In biologically catalyzed reactions, the reactants are known as substrates, and the catalysts are naturally occurring macromolecular substances known as enzymes. Enzymes possess specific binding sites for substrates, and are usually composed wholly or largely of protein, but RNA that has catalytic activity (ribozyme) is often also regarded as enzymatic. ; metabolic process : The chemical reactions and pathways, including anabolism and catabolism, by which living organisms transform chemical substances. Metabolic processes typically transform small molecules, but also include macromolecular processes such as DNA repair and replication, and protein synthesis and degradation. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; immune system process : Any process involved in the development or functioning of the immune system, an organismal system for calibrated responses to potential internal or invasive threats. ; innate immune response : Innate immune responses are defense responses mediated by germline encoded components that directly recognize components of potential pathogens. ; inflammatory response : The immediate defensive reaction (by vertebrate tissue) to infection or injury caused by chemical or physical agents. The process is characterized by local vasodilation, extravasation of plasma into intercellular spaces and accumulation of white blood cells and macrophages. ; fructose 6-phosphate metabolic process : The chemical reactions and pathways involving fructose 6-phosphate, also known as F6P. The D-enantiomer is an important intermediate in glycolysis, gluconeogenesis, and fructose metabolism. ; fructokinase activity : Catalysis of the reaction: ATP + D-fructose = ADP + D-fructose 6-phosphate. ; mannokinase activity : Catalysis of the reaction: ATP + D-mannose = ADP + D-mannose 6-phosphate. ; peptidoglycan binding : Interacting selectively and non-covalently, in a non-covalent manner, with peptidoglycan, any of a class of glycoconjugates found in bacterial cell walls. ; glucosamine kinase activity : Catalysis of the reaction: ATP + D-glucosamine = ADP + D-glucosamine phosphate. ; mannose metabolic process : The chemical reactions and pathways involving mannose, the aldohexose manno-hexose, the C-2 epimer of glucose. The D-(+)-form is widely distributed in mannans and hemicelluloses and is of major importance in the core oligosaccharide of N-linked oligosaccharides of glycoproteins. ; canonical glycolysis : The glycolytic process that begins with the conversion of glucose to glucose-6-phosphate by glucokinase activity. Glycolytic processes are the chemical reactions and pathways resulting in the breakdown of a carbohydrate into pyruvate, with the concomitant production of a small amount of ATP. ; establishment of protein localization to mitochondrion : The directed movement of a protein to the mitochondrion or a part of the mitochondrion. ; maintenance of protein location in mitochondrion : Any process in which a protein is maintained in a specific location in a mitochondrion, and is prevented from moving elsewhere. ; positive regulation of cytokine production involved in immune response : Any process that activates or increases the frequency, rate, or extent of cytokine production that contributes to an immune response. ; positive regulation of interleukin-1 beta production : Any process that activates or increases the frequency, rate, or extent of interleukin-1 beta production. ; membrane raft : Any of the small (10-200 nm), heterogeneous, highly dynamic, sterol- and sphingolipid-enriched membrane domains that compartmentalize cellular processes. Small rafts can sometimes be stabilized to form larger platforms through protein-protein and protein-lipid interactions. ;


Symbol
HK1
Name
hexokinase 1
Entrez ID
3098
Ensembl ID
ENSG00000156515    (more details)
KEGG ID
hsa:3098    (more details)
OMIM ID
142600
Uniprot ID
A8K7J7  
GO ID
hsa:3098    (more details)
Chromosome
10
Strand
1
Start
69269984
End
69401884
miRNA Interactions
hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-15b-5p (RPM: 133.5752) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-424-5p (RPM: 9.04) / hsa-miR-106a-5p (RPM: 7.9736) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-541-3p (RPM: 0.7484) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-138-5p (RPM: 67.2828) / hsa-miR-503-5p (RPM: 0.0972) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-129-1-3p (RPM: 8.647) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-127-5p (RPM: 9.9124) / hsa-miR-876-3p (RPM: 0.2528) / hsa-miR-1296-5p (RPM: 36.5114) / hsa-miR-494-3p (RPM: 1.1806) / hsa-miR-22-3p (RPM: 26348.475) / hsa-miR-181a-5p (RPM: 52364.6344) / hsa-miR-449b-5p (RPM: 1.2108) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-34c-5p (RPM: 46.7356) / hsa-miR-659-3p (RPM: 0.0056) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-421 (RPM: 76.7678) / hsa-miR-625-5p (RPM: 10.5462) / hsa-miR-615-3p (RPM: 0.1424) / hsa-miR-17-3p (RPM: 13.6088) / hsa-miR-342-3p (RPM: 685.7862) / hsa-miR-330-3p (RPM: 21.3424) / hsa-miR-34b-5p (RPM: 1.8778) / hsa-miR-93-5p (RPM: 357.1536) / hsa-miR-532-3p (RPM: 21.9476) / hsa-miR-552-3p (RPM: 0.0608) / hsa-miR-181a-2-3p (RPM: 1451.5764) / hsa-miR-125a-3p (RPM: 24.5112) / hsa-miR-15a-3p (RPM: 0.0624) / hsa-miR-182-3p (RPM: 20.9678) / hsa-miR-10b-5p (RPM: 14052.6542) / hsa-miR-10a-5p (RPM: 408.7974) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-191-5p (RPM: 12993.8088) / hsa-miR-99b-5p (RPM: 14318.7458) / hsa-miR-324-5p (RPM: 32.337) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGATCGCCGCGCAGCTCCTGGCCTATTACTTCACGGAGCTGAAGGATGACCAGGTCAAAAAGATTGACAAGTATCTCTATGCCATGCGGCTCTCCGATGAAACTCTCATAGATATCATGACTCGCTTCAGGAAGGAGATGAAGAATGGCCTCTCCCGGGATTTTAATCCAACAGCCACAGTCAAGATGTTGCCAACATTCGTAAGGTCCATTCCTGATGGCTCTGAAAAGGGAGATTTCATTGCCCTGGATCTTGGTGGGTCTTCCTTTCGAATTCTGCGGGTGCAAGTGAATCATGAGAAAAACCAGAATGTTCACATGGAGTCCGAGGTTTATGACACCCCAGAGAACATCGTGCACGGCAGTGGAAGCCAGCTTTTTGATCATGTTGCTGAGTGCCTGGGAGATTTCATGGAGAAAAGGAAGATCAAGGACAAGAAGTTACCTGTGGGATTCACGTTTTCTTTTCCTTGCCAACAATCCAAAATAGATGAGGCCATCCTGATCACCTGGACAAAGCGATTTAAAGCGAGCGGAGTGGAAGGAGCAGATGTGGTCAAACTGCTTAACAAAGCCATCAAAAAGCGAGGGGACTATGATGCCAACATCGTAGCTGTGGTGAATGACACAGTGGGCACCATGATGACCTGTGGCTATGACGACCAGCACTGTGAAGTCGGCCTGATCATCGGCACTGGCACCAATGCTTGCTACATGGAGGAACTGAGGCACATTGATCTGGTGGAAGGAGACGAGGGGAGGATGTGTATCAATACAGAATGGGGAGCCTTTGGAGACGATGGATCATTAGAAGACATCCGGACAGAGTTTGACAGGGAGATAGACCGGGGATCCCTCAACCCTGGAAAACAGCTGTTTGAGAAGATGGTCAGTGGCATGTACTTGGGAGAGCTGGTTCGACTGATCCTAGTCAAGATGGCCAAGGAGGGCCTCTTATTTGAAGGGCGGATCACCCCGGAGCTGCTCACCCGAGGGAAGTTTAACACCAGTGATGTGTCAGCCATCGAAAAGAATAAGGAAGGCCTCCACAATGCCAAAGAAATCCTGACCCGCCTGGGAGTGGAGCCGTCCGATGATGACTGTGTCTCAGTCCAGCACGTTTGCACCATTGTCTCATTTCGCTCAGCCAACTTGGTGGCTGCCACACTGGGCGCCATCTTGAACCGCCTGCGTGATAACAAGGGCACACCCAGGCTGCGGACCACGGTTGGTGTCGACGGATCTCTTTACAAGACGCACCCACAGTATTCCCGGCGTTTCCACAAGACTCTAAGGCGCTTGGTGCCAGACTCCGATGTGCGCTTCCTCCTCTCGGAGAGTGGCAGCGGCAAGGGGGCTGCCATGGTGACGGCGGTGGCCTACCGCTTGGCCGAGCAGCACCGGCAGATAGAGGAGACCCTGGCTCATTTCCACCTCACCAAGGACATGCTGCTGGAGGTGAAGAAGAGGATGCGGGCCGAGATGGAGCTGGGGCTGAGGAAGCAGACGCACAACAATGCCGTGGTTAAGATGCTGCCCTCCTTCGTCCGGAGAACTCCCGACGGGACCGAGAATGGTGACTTCTTGGCCCTGGATCTTGGAGGAACCAATTTCCGTGTGCTGCTGGTGAAAATCCGTAGTGGGAAAAAGAGAACGGTGGAAATGCACAACAAGATCTACGCCATTCCTATTGAAATCATGCAGGGCACTGGGGAAGAGCTGTTTGATCACATTGTCTCCTGCATCTCTGACTTCTTGGACTACATGGGGATCAAAGGCCCCAGGATGCCTCTGGGCTTCACGTTCTCATTTCCCTGCCAGCAGACGAGTCTGGACGCGGGAATCTTGATCACGTGGACAAAGGGTTTTAAGGCAACAGACTGCGTGGGCCACGATGTAGTCACCTTACTAAGGGATGCGATAAAAAGGAGAGAGGAATTTGACCTGGACGTGGTGGCTGTGGTCAACGACACAGTGGGCACCATGATGACCTGTGCTTATGAGGAGCCCACCTGTGAGGTTGGACTCATTGTTGGGACCGGCAGCAATGCCTGCTACATGGAGGAGATGAAGAACGTGGAGATGGTGGAGGGGGACCAGGGGCAGATGTGCATCAACATGGAGTGGGGGGCCTTTGGGGACAACGGGTGTCTGGATGATATCAGGACACACTACGACAGACTGGTGGACGAATATTCCCTAAATGCTGGGAAACAAAGGTATGAGAAGATGATCAGTGGTATGTACCTGGGTGAAATCGTCCGCAACATCTTAATCGACTTCACCAAGAAGGGATTCCTCTTCCGAGGGCAGATCTCTGAGACGCTGAAGACCCGGGGCATCTTTGAGACCAAGTTTCTCTCTCAGATCGAGAGTGACCGATTAGCACTGCTCCAGGTCCGGGCTATCCTCCAGCAGCTAGGTCTGAATAGCACCTGCGATGACAGTATCCTCGTCAAGACAGTGTGCGGGGTGGTGTCCAGGAGGGCCGCACAGCTGTGTGGCGCAGGCATGGCTGCGGTTGTGGATAAGATCCGCGAGAACAGAGGACTGGACCGTCTGAATGTGACTGTGGGAGTGGACGGGACACTCTACAAGCTTCATCCACACTTCTCCAGAATCATGCACCAGACGGTGAAGGAACTGTCACCAAAATGTAACGTGTCCTTCCTCCTGTCTGAGGATGGCAGCGGCAAGGGGGCCGCCCTCATCACGGCCGTGGGCGTGCGGTTACGCACAGAGGCAAGCAGCTAA

Back to List