Details for gene: IFT43


intraciliary transport particle A : The smaller subcomplex of the intraciliary transport particle; characterized complexes have molecular weights of 710-760 kDa. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; cilium : A specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface and of some cytoplasmic parts. Each cilium is largely bounded by an extrusion of the cytoplasmic (plasma) membrane, and contains a regular longitudinal array of microtubules, anchored to a basal body. ; cytoskeleton : Any of the various filamentous elements that form the internal framework of cells, and typically remain after treatment of the cells with mild detergent to remove membrane constituents and soluble components of the cytoplasm. The term embraces intermediate filaments, microfilaments, microtubules, the microtrabecular lattice, and other structures characterized by a polymeric filamentous nature and long-range order within the cell. The various elements of the cytoskeleton not only serve in the maintenance of cellular shape but also have roles in other cellular functions, including cellular movement, cell division, endocytosis, and movement of organelles. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; microtubule cytoskeleton : The part of the cytoskeleton (the internal framework of a cell) composed of microtubules and associated proteins. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; centriolar satellite : A small (70-100 nm) cytoplasmic granule that contains a number of centrosomal proteins; centriolar satellites traffic toward microtubule minus ends and are enriched near the centrosome. ; cilium assembly : The assembly of a cilium, a specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface. Each cilium is bounded by an extrusion of the cytoplasmic membrane, and contains a regular longitudinal array of microtubules, anchored basally in a centriole. ; cell projection organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of a prolongation or process extending from a cell, e.g. a flagellum or axon. ; ciliary tip : Part of the cilium where the axoneme ends. The ciliary tip has been implicated in ciliary assembly and disassembly, as well as signal transduction. ; intraciliary retrograde transport : The directed movement of large protein complexes along microtubules from the tip of a cilium (also called flagellum) toward the cell body, mediated by motor proteins. ;


Symbol
IFT43
Name
intraflagellar transport 43
Entrez ID
112752
Ensembl ID
ENSG00000119650    (more details)
KEGG ID
hsa:112752    (more details)
OMIM ID
614068
Uniprot ID
Q96FT9  
GO ID
hsa:112752    (more details)
Chromosome
14
Strand
1
Start
75902136
End
76084585
miRNA Interactions
hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-186-5p (RPM: 1645.2832) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-412-3p (RPM: 0.02) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-22-5p (RPM: 21.6092) / hsa-miR-1267 (RPM: 0.087) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-191-5p (RPM: 12993.8088) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Metabolic pathways / Glycolysis / Gluconeogenesis / Fructose and mannose metabolism / Galactose metabolism / Amino sugar and nucleotide sugar metabolism / HIF-1 signaling pathway / Central carbon metabolism in cancer / Carbon metabolism / Insulin signaling pathway / Carbohydrate digestion and absorption / Biosynthesis of antibiotics / Starch and sucrose metabolism / Butirosin and neomycin biosynthesis /
Sequence
ATGGAGGATTTGCTCGACTTGGACGAGGAGCTTCGCTACAGCTTGGCTACCTCCAGGGCCAAGATGGGTCGCCGAGCTCAACAGGAGTCAGCGCAGGCCGAGAATCACCTCAATGGCAAGAATTCCTCTTTGACTCTGACTGGAGAGACTTCCTCTGCTAAATTACCTCGCTGCCGACAGGGAGGCTGGGCAGGTGATTCCGTGAAGGCTTCGAAGTTTAGGAGGAAGGCTTCTGAAGAAATAGAAGATTTCCGCCTCAGACCACAGAGCCTGAATGGATCAGATTATGGAGGAGATATTCCTATCATTCCGGATCTGGAGGAAGTACAGGAAGAAGACTTTGTTTTGCAGGTGGCAGCCCCTCCCAGCATCCAGATAAAGCGGGTGATGACCTACCGTGACCTGGACAATGACCTCATGAAGTACTCAGCCATTCAGACACTGGATGGGGAGATCGACCTGAAACTCCTCACCAAAGTGCTCGCGCCGGAGCACGAAGTCCGGGAGGATGATGTCGGCTGGGACTGGGACCATCTGTTCACTGAGGTGTCCTCAGAGGTCCTCACTGAGTGGGACCCACTGCAGACGGAGAAGGAGGACCCTGCGGGGCAGGCCAGGCACACCTGA

Back to List