Details for gene: KIF3B


ATP binding : Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator. ; microtubule binding : Interacting selectively and non-covalently with microtubules, filaments composed of tubulin monomers. ; ATP-dependent microtubule motor activity : Catalysis of movement along a microtubule, coupled to the hydrolysis of ATP. ; microtubule-based movement : A microtubule-based process that results in the movement of organelles, other microtubules, or other cellular components. Examples include motor-driven movement along microtubules and movement driven by polymerization or depolymerization of microtubules. ; microtubule motor activity : Generation of movement along a microtubule, driven by ATP hydrolysis. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; nucleotide binding : Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose. ; cilium : A specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface and of some cytoplasmic parts. Each cilium is largely bounded by an extrusion of the cytoplasmic (plasma) membrane, and contains a regular longitudinal array of microtubules, anchored to a basal body. ; dendrite cytoplasm : All of the contents of a dendrite, excluding the surrounding plasma membrane. ; cytoskeleton : Any of the various filamentous elements that form the internal framework of cells, and typically remain after treatment of the cells with mild detergent to remove membrane constituents and soluble components of the cytoplasm. The term embraces intermediate filaments, microfilaments, microtubules, the microtrabecular lattice, and other structures characterized by a polymeric filamentous nature and long-range order within the cell. The various elements of the cytoskeleton not only serve in the maintenance of cellular shape but also have roles in other cellular functions, including cellular movement, cell division, endocytosis, and movement of organelles. ; cell junction : A cellular component that forms a specialized region of connection between two or more cells, or between a cell and the extracellular matrix, or between two membrane-bound components of a cell, such as flagella. ; axon cytoplasm : Any cytoplasm that is part of a axon. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; dendrite : A neuron projection that has a short, tapering, morphology. Dendrites receive and integrate signals from other neurons or from sensory stimuli, and conduct nerve impulses towards the axon or the cell body. In most neurons, the impulse is conveyed from dendrites to axon via the cell body, but in some types of unipolar neuron, the impulse does not travel via the cell body. ; microtubule : Any of the long, generally straight, hollow tubes of internal diameter 12-15 nm and external diameter 24 nm found in a wide variety of eukaryotic cells; each consists (usually) of 13 protofilaments of polymeric tubulin, staggered in such a manner that the tubulin monomers are arranged in a helical pattern on the microtubular surface, and with the alpha/beta axes of the tubulin subunits parallel to the long axis of the tubule; exist in equilibrium with pool of tubulin monomers and can be rapidly assembled or disassembled in response to physiological stimuli; concerned with force generation, e.g. in the spindle. ; synapse : The junction between an axon of one neuron and a dendrite of another neuron, a muscle fiber or a glial cell. As the axon approaches the synapse it enlarges into a specialized structure, the presynaptic terminal bouton, which contains mitochondria and synaptic vesicles. At the tip of the terminal bouton is the presynaptic membrane; facing it, and separated from it by a minute cleft (the synaptic cleft) is a specialized area of membrane on the receiving cell, known as the postsynaptic membrane. In response to the arrival of nerve impulses, the presynaptic terminal bouton secretes molecules of neurotransmitters into the synaptic cleft. These diffuse across the cleft and transmit the signal to the postsynaptic membrane. ; cilium assembly : The assembly of a cilium, a specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface. Each cilium is bounded by an extrusion of the cytoplasmic membrane, and contains a regular longitudinal array of microtubules, anchored basally in a centriole. ; ATPase : A molecular function characterized by the use of ATP hydrolysis as an energy source, for example to catalyze a reaction or drive transport against a concentration gradient. ; dendritic spine : A small, membranous protrusion from a dendrite that forms a postsynaptic compartment, typically receiving input from a single presynapse. They function as partially isolated biochemical and an electrical compartments. Spine morphology is variable:they can be thin, stubby, mushroom, or branched, with a continuum of intermediate morphologies. They typically terminate in a bulb shape, linked to the dendritic shaft by a restriction. Spine remodeling is though to be involved in synaptic plasticity. ; intraciliary transport : The bidirectional movement of large protein complexes along microtubules within a cilium, mediated by motor proteins. ; ciliary tip : Part of the cilium where the axoneme ends. The ciliary tip has been implicated in ciliary assembly and disassembly, as well as signal transduction. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; extracellular exosome : A vesicle that is released into the extracellular region by fusion of the limiting endosomal membrane of a multivesicular body with the plasma membrane. Extracellular exosomes, also simply called exosomes, have a diameter of about 40-100 nm. ; kinesin complex : Any complex that includes a dimer of molecules from the kinesin superfamily, a group of related proteins that contain an extended region of predicted alpha-helical coiled coil in the main chain that likely produces dimerization. The native complexes of several kinesin family members have also been shown to contain additional peptides, often designated light chains as all of the noncatalytic subunits that are currently known are smaller than the chain that contains the motor unit. Kinesin complexes generally possess a force-generating enzymatic activity, or motor, which converts the free energy of the gamma phosphate bond of ATP into mechanical work. ; spindle microtubule : Any microtubule that is part of a mitotic or meiotic spindle; anchored at one spindle pole. ; microtubule cytoskeleton : The part of the cytoskeleton (the internal framework of a cell) composed of microtubules and associated proteins. ; mitotic spindle assembly : Mitotic bipolar spindle assembly begins with spindle microtubule nucleation from the separated spindle pole body, includes spindle elongation during prometaphase, and is complete when all kinetochores are stably attached the spindle, and the spindle assembly checkpoint is satisfied. ; centrosome : A structure comprised of a core structure (in most organisms, a pair of centrioles) and peripheral material from which a microtubule-based structure, such as a spindle apparatus, is organized. Centrosomes occur close to the nucleus during interphase in many eukaryotic cells, though in animal cells it changes continually during the cell-division cycle. ; ATP-dependent microtubule motor activity, plus-end-directed : Catalysis of movement along a microtubule toward the plus end, coupled to the hydrolysis of ATP. ; small GTPase binding : Interacting selectively and non-covalently with a small monomeric GTPase. ; intraciliary transport particle B binding : Interacting selectively and non-covalently with an intraciliary transport particle B (IFT B) complex. ; mitotic spindle organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of the microtubule spindle during a mitotic cell cycle. ; mitotic centrosome separation : Separation of duplicated centrosome components at the beginning of mitosis. The centriole pair within each centrosome becomes part of a separate microtubule organizing center that nucleates a radial array of microtubules called an aster. The two asters move to opposite sides of the nucleus to form the two poles of the mitotic spindle. ; determination of left/right symmetry : The establishment of an organism's body plan or part of an organism with respect to the left and right halves. The pattern can either be symmetric, such that the halves are mirror images, or asymmetric where the pattern deviates from this symmetry. ; anterograde axonal transport : The directed movement of organelles or molecules along microtubules from the cell body toward the cell periphery in nerve cell axons. ; vesicle-mediated transport : A cellular transport process in which transported substances are moved in membrane-bounded vesicles; transported substances are enclosed in the vesicle lumen or located in the vesicle membrane. The process begins with a step that directs a substance to the forming vesicle, and includes vesicle budding and coating. Vesicles are then targeted to, and fuse with, an acceptor membrane. ; positive regulation of cytokinesis : Any process that activates or increases the frequency, rate or extent of the division of the cytoplasm of a cell, and its separation into two daughter cells. ; opsin transport : The directed movement of an opsin (a G protein-coupled receptor of photoreceptor cells) into, out of or within a cell, or between cells, or within a multicellular organism by means of some agent such as a transporter or pore. ; plus-end-directed vesicle transport along microtubule : The directed movement of a vesicle towards the plus end of a microtubule, mediated by motor proteins. This process begins with the attachment of a vesicle to a microtubule, and ends when the vesicle reaches its final destination. ; anterograde dendritic transport of neurotransmitter receptor complex : The directed movement of a neurotransmitter receptor complex along microtubules in nerve cell dendrites towards the postsynapse. ; spindle : The array of microtubules and associated molecules that forms between opposite poles of a eukaryotic cell during mitosis or meiosis and serves to move the duplicated chromosomes apart. ; plus-end kinesin complex : Any complex that includes a dimer of molecules from the kinesin superfamily and any associated proteins, and moves towards the plus end of a microtubule. ; kinesin II complex : A complex consisting of two distinct motor subunits that form a heterodimer complexed with a third non-motor accessory subunit, the kinesin associated protein or KAP; the KIF3 heterodimer interacts via its C-terminal portion with KAP, which is thought to regulate the binding of the motor to cargo membranes. ; axon : The long process of a neuron that conducts nerve impulses, usually away from the cell body to the terminals and varicosities, which are sites of storage and release of neurotransmitter. ; midbody : A thin cytoplasmic bridge formed between daughter cells at the end of cytokinesis. The midbody forms where the contractile ring constricts, and may persist for some time before finally breaking to complete cytokinesis. ;


Symbol
KIF3B
Name
kinesin family member 3B
Entrez ID
9371
Ensembl ID
ENSG00000101350    (more details)
KEGG ID
hsa:9371    (more details)
OMIM ID
603754
Uniprot ID
O15066  
GO ID
hsa:9371    (more details)
Chromosome
22
Strand
1
Start
25212564
End
25231870
miRNA Interactions
hsa-miR-30c-5p (RPM: 3890.0396) / hsa-miR-15a-5p (RPM: 139.425) / hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-133a-3p (RPM: 411.6588) / hsa-miR-30d-5p (RPM: 9562.1366) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-15b-5p (RPM: 133.5752) / hsa-miR-30e-5p (RPM: 2305.0396) / hsa-miR-423-5p (RPM: 976.289) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-1304-5p (RPM: 0.1148) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-27b-3p (RPM: 22876.2392) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-30b-5p (RPM: 1466.5144) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-338-3p (RPM: 158.4942) / hsa-miR-544a (RPM: 0.082) / hsa-miR-92a-3p (RPM: 16961.15) / hsa-miR-129-5p (RPM: 135.1492) / hsa-miR-92b-3p (RPM: 8345.0264) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-96-5p (RPM: 1417.2834) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-18b-3p (RPM: 0.2006) / hsa-miR-23b-5p (RPM: 1.333) / hsa-miR-186-5p (RPM: 1645.2832) / hsa-miR-221-3p (RPM: 758.7978) / hsa-miR-30e-3p (RPM: 538.304) / hsa-miR-30a-3p (RPM: 889.1386) / hsa-miR-148a-5p (RPM: 130.608) / hsa-miR-7-1-3p (RPM: 13.9534) / hsa-miR-542-3p (RPM: 2.7294) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-4682 (RPM: 0.1592) / hsa-miR-432-5p (RPM: 29.044) / hsa-miR-1226-5p (RPM: 0.426) / hsa-miR-410-3p (RPM: 194.4724) / hsa-miR-5194 (RPM: 0.0082) / hsa-miR-545-5p (RPM: 0.3484) / hsa-miR-204-5p (RPM: 265062.0076) / hsa-miR-127-3p (RPM: 3339.395) / hsa-miR-3928-3p (RPM: 0.5162) / hsa-miR-5698 (RPM: 0.003) / hsa-miR-105-5p (RPM: 5.4344) / hsa-miR-181d-5p (RPM: 168.2728) / hsa-miR-181b-5p (RPM: 3069.8278) / hsa-miR-181c-5p (RPM: 1285.07) / hsa-miR-181a-5p (RPM: 52364.6344) / hsa-miR-92a-1-5p (RPM: 8.113) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-4716-3p (RPM: 0.0022) / hsa-miR-197-3p (RPM: 347.3274) / hsa-miR-4723-5p (RPM: 0.114) / hsa-miR-4254 (RPM: 0.0334) / hsa-miR-485-3p (RPM: 10.0736) / hsa-miR-4646-5p (RPM: 0.0142) / hsa-miR-3173-5p (RPM: 0.4582) / hsa-miR-22-5p (RPM: 21.6092) / hsa-miR-25-3p (RPM: 1063.0626) / hsa-miR-221-5p (RPM: 32.1456) / hsa-miR-146b-3p (RPM: 16.408) / hsa-miR-204-3p (RPM: 409.3428) / hsa-miR-218-1-3p (RPM: 0.0242) / hsa-miR-224-5p (RPM: 33.3102) / hsa-miR-222-3p (RPM: 1699.0194) / hsa-miR-1292-5p (RPM: 0.815) / hsa-miR-1271-5p (RPM: 29.1658) / hsa-miR-4424 (RPM: 0.593) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-874-3p (RPM: 170.3494) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-1914-3p (RPM: 0.0102) / hsa-miR-1910-5p (RPM: 8.4774) / hsa-miR-483-3p (RPM: 2.3898) / hsa-miR-16-1-3p (RPM: 0.0972) / hsa-miR-29a-5p (RPM: 3.125) / hsa-miR-296-3p (RPM: 8.5012) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-10a-5p (RPM: 408.7974) / hsa-miR-483-5p (RPM: 0.9526) / hsa-miR-324-5p (RPM: 32.337) / hsa-miR-6750-3p (RPM: 0.1284) / hsa-miR-6791-5p (RPM: 0.0078) / hsa-miR-7976 (RPM: 0.2208) / hsa-miR-6834-5p (RPM: 0.0274) / hsa-miR-7111-5p (RPM: 0.0178) / hsa-miR-6870-5p (RPM: 0.0012) / hsa-miR-6794-5p (RPM: 0.0488) / hsa-miR-6799-3p (RPM: 0.0528) / hsa-miR-6734-5p (RPM: 0.3692) / hsa-miR-6738-5p (RPM: 0.0046) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGTCAAAGTTGAAAAGCTCAGAGTCAGTCAGGGTGGTGGTTCGCTGTCGGCCCATGAATGGCAAGGAAAAGGCTGCTTCGTATGACAAAGTGGTGGATGTGGATGTTAAGCTGGGGCAGGTGTCTGTGAAGAACCCCAAAGGGACGGCCCATGAAATGCCCAAGACCTTCACCTTTGATGCCGTCTATGACTGGAATGCCAAGCAGTTTGAACTGTACGATGAGACGTTCCGACCACTTGTTGACTCTGTCCTGCAAGGTTTCAATGGAACCATTTTTGCCTATGGACAAACTGGGACAGGAAAAACCTACACCATGGAAGGAATCCGTGGTGACCCTGAAAAAAGAGGAGTCATTCCTAACTCATTTGACCATATCTTCACCCACATCTCTCGATCCCAGAATCAACAATACCTGGTCAGGGCTTCTTACTTAGAGATCTACCAGGAGGAGATCCGAGATTTGCTCTCAAAGGATCAGACCAAAAGGCTTGAGCTCAAAGAGAGGCCTGACACAGGAGTGTATGTGAAAGACCTGTCTTCCTTTGTCACCAAGAGTGTGAAGGAGATAGAGCATGTGATGAATGTGGGGAACCAGAACCGTTCTGTCGGTGCTACCAACATGAACGAGCACAGCTCGCGTTCTCATGCAATTTTCGTTATCACTATTGAGTGCAGCGAGGTGGGCCTCGATGGTGAAAACCACATCCGTGTAGGAAAATTGAACCTTGTAGATCTTGCTGGCAGCGAACGGCAAGCCAAGACCGGCGCACAAGGGGAGAGATTAAAAGAAGCTACCAAGATCAACCTCTCCCTTTCCGCTTTGGGTAATGTCATCTCTGCTCTAGTGGACGGCAAAAGCACTCACATTCCATATCGGGACTCAAAGCTTACCAGGCTCCTCCAAGATTCCCTTGGTGGCAATGCCAAGACTGTGATGGTGGCCAACGTGGGGCCTGCCTCTTACAACGTAGAAGAGACTCTGACCACTCTGCGATATGCCAACCGTGCCAAAAACATTAAGAACAAACCAAGGGTCAATGAGGACCCCAAGGATGCCCTCCTTCGAGAATTCCAGGAAGAGATTGCTCGGCTCAAGGCCCAGCTGGAAAAACGGTCCATTGGTAGGAGGAAGAGGCGAGAGAAGCGGAGGGAAGGTGGTGGCAGTGGTGGGGGTGGGGAAGAGGAGGAGGAGGAGGGAGAAGAGGGTGAGGAGGAAGGGGATGATAAGGATGATTACTGGCGGGAACAGCAAGAAAAACTGGAGATTGAGAAGCGGGCCATTGTAGAGGATCACAGCTTGGTTGCAGAGGAGAAGATGAGGCTGCTGAAGGAGAAAGAGAAAAAGATGGAGGACCTGCGGCGGGAGAAGGATGCTGCCGAGATGCTGGGCGCCAAGATCAAGGCCATGGAGAGTAAGTTGCTTGTTGGAGGAAAAAATATAGTAGATCATACGAATGAACAGCAGAAAATCCTGGAGCAGAAACGACAGGAAATTGCAGAGCAGAAACGTCGAGAAAGAGAAATCCAGCAACAGATGGAAAGTCGAGATGAGGAGACCTTGGAACTTAAAGAGACATACAGCTCATTGCAGCAAGAGGTGGACATCAAGACCAAAAAACTCAAAAAGCTCTTCTCCAAGCTTCAGGCAGTGAAGGCTGAGATCCATGACCTCCAAGAAGAACACATCAAGGAGCGCCAAGAGCTAGAGCAGACTCAGAATGAGCTCACCAGGGAGCTGAAACTCAAGCATCTTATTATAGAAAACTTTATCCCTCTGGAAGAAAAAAGTAAAATTATGAATAGAGCCTTCTTTGATGAAGAGGAAGATCATTGGAAACTACATCCTATAACCAGACTGGAGAACCAGCAGATGATGAAGCGGCCAGTCTCAGCCGTGGGATATAAGAGACCATTGAGCCAGCACGCAAGAATGTCCATGATGATTCGTCCAGAGGCCCGATATAGGGCAGAAAACATTGTGCTGTTAGAGCTGGACATGCCCAGCCGGACCACCAGAGACTATGAGGGTCCAGCCATTGCCCCCAAGGTCCAGGCTGCATTGGATGCGGCTCTGCAGGATGAAGATGAGATACAGGTGGATGCATCATCATTTGAAAGCACTGCAAATAAGAAATCCAAGGCCAGGCCTAAAAGTGGAAGGAAGTCGGGATCCTCCTCCTCTTCCTCAGGAACCCCTGCATCTCAGCTTTATCCACAGTCTCGGGGGCTGGTTCCAAAGTAA

Back to List