Details for gene: RDH11


oxidoreductase activity : Catalysis of an oxidation-reduction (redox) reaction, a reversible chemical reaction in which the oxidation state of an atom or atoms within a molecule is altered. One substrate acts as a hydrogen or electron donor and becomes oxidized, while the other acts as hydrogen or electron acceptor and becomes reduced. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; endoplasmic reticulum : The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached). ; endoplasmic reticulum membrane : The lipid bilayer surrounding the endoplasmic reticulum. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; NADP-retinol dehydrogenase activity : Catalysis of the reaction: all-trans-retinol + NADP+ = all-trans-retinal + NADPH + H+. ; retinol metabolic process : The chemical reactions and pathways involving retinol, one of the three compounds that makes up vitamin A. ; retinoid metabolic process : The chemical reactions and pathways involving retinoids, any member of a class of isoprenoids that contain or are derived from four prenyl groups linked head-to-tail. Retinoids include retinol and retinal and structurally similar natural derivatives or synthetic compounds, but need not have vitamin A activity. ; NAD-retinol dehydrogenase activity : Catalysis of the reaction: retinol + NAD+ = retinal + NADH + H+. ; cellular detoxification of aldehyde : Any process carried out at the cellular level that reduces or removes the toxicity of an aldehyde. These may include transport of aldehydes away from sensitive areas and to compartments or complexes whose purpose is sequestration of the toxic substance. ; retinal metabolic process : The chemical reactions and pathways involving retinal, a compound that plays an important role in the visual process in most vertebrates. In the retina, retinal combines with opsins to form visual pigments. Retinal is one of the forms of vitamin A. ; oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor : Catalysis of an oxidation-reduction (redox) reaction in which a CH-OH group acts as a hydrogen or electron donor and reduces NAD+ or NADP. ; 11-cis-retinol dehydrogenase activity : Catalysis of the reaction: 11-cis-retinol + NADP = 11-cis-retinal + NADPH + H+. ;


Symbol
RDH11
Name
retinol dehydrogenase 11
Entrez ID
51109
Ensembl ID
ENSG00000072042    (more details)
KEGG ID
hsa:51109    (more details)
OMIM ID
607849
Uniprot ID
Q8TC12  
GO ID
hsa:51109    (more details)
Chromosome
14
Strand
-1
Start
67676800
End
67695793
miRNA Interactions
hsa-miR-15a-5p (RPM: 139.425) / hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-29c-3p (RPM: 661.3514) / hsa-miR-133a-3p (RPM: 411.6588) / hsa-miR-4524a-5p (RPM: 0.0932) / hsa-miR-15b-5p (RPM: 133.5752) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-454-3p (RPM: 66.0634) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-106a-5p (RPM: 7.9736) / hsa-miR-183-5p (RPM: 37556.6894) / hsa-miR-4775 (RPM: 1.173) / hsa-miR-135a-5p (RPM: 34.8504) / hsa-miR-19b-3p (RPM: 197.0578) / hsa-miR-3187-3p (RPM: 1.1952) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-1323 (RPM: 0.0072) / hsa-miR-590-3p (RPM: 4.5954) / hsa-miR-129-5p (RPM: 135.1492) / hsa-miR-3662 (RPM: 0.0344) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-96-5p (RPM: 1417.2834) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-130a-3p (RPM: 723.372) / hsa-miR-32-3p (RPM: 2.4438) / hsa-miR-361-5p (RPM: 182.4758) / hsa-miR-548o-3p (RPM: 3.2198) / hsa-miR-452-5p (RPM: 23.696) / hsa-miR-130b-3p (RPM: 68.2014) / hsa-miR-153-3p (RPM: 53.4548) / hsa-miR-429 (RPM: 100.5032) / hsa-miR-588 (RPM: 0.0032) / hsa-miR-449a (RPM: 1.3118) / hsa-miR-3128 (RPM: 0.0088) / hsa-miR-301b-3p (RPM: 9.609) / hsa-miR-301a-3p (RPM: 142.8494) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-1293 (RPM: 0.4392) / hsa-miR-3064-3p (RPM: 0.0822) / hsa-miR-328-3p (RPM: 137.931) / hsa-miR-548s (RPM: 0.1718) / hsa-miR-194-5p (RPM: 48.9448) / hsa-miR-519b-3p (RPM: 0.0036) / hsa-miR-576-5p (RPM: 10.7352) / hsa-miR-519a-3p (RPM: 0.0036) / hsa-miR-21-5p (RPM: 5494.851) / hsa-miR-29b-1-5p (RPM: 1.1774) / hsa-miR-203a-3p (RPM: 1346.5646) / hsa-miR-203b-3p (RPM: 3.2494) / hsa-miR-519c-3p (RPM: 0.0096) / hsa-miR-411-5p (RPM: 354.94) / hsa-miR-514a-5p (RPM: 0.2046) / hsa-miR-548d-5p (RPM: 1.1692) / hsa-miR-548a-5p (RPM: 0.0098) / hsa-miR-548i (RPM: 1.7968) / hsa-miR-548ar-5p (RPM: 0.0164) / hsa-miR-548ap-5p (RPM: 0.0048) / hsa-miR-548au-5p (RPM: 0.1902) / hsa-miR-449b-5p (RPM: 1.2108) / hsa-miR-548as-5p (RPM: 0.0316) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-122-5p (RPM: 0.5028) / hsa-miR-548c-5p (RPM: 0.235) / hsa-miR-548b-5p (RPM: 0.2842) / hsa-miR-548am-5p (RPM: 0.2292) / hsa-miR-2115-3p (RPM: 0.1268) / hsa-miR-548o-5p (RPM: 0.235) / hsa-miR-548ab (RPM: 0.3238) / hsa-miR-548y (RPM: 0.046) / hsa-miR-197-3p (RPM: 347.3274) / hsa-miR-548h-5p (RPM: 0.3692) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-34c-5p (RPM: 46.7356) / hsa-miR-378b (RPM: 0.313) / hsa-miR-548j-5p (RPM: 0.0632) / hsa-miR-378c (RPM: 29.1044) / hsa-miR-320b (RPM: 35.0146) / hsa-miR-378a-3p (RPM: 1540.7796) / hsa-miR-4638-3p (RPM: 0.8582) / hsa-miR-378f (RPM: 0.9286) / hsa-miR-548w (RPM: 0.4064) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-92a-2-5p (RPM: 0.5724) / hsa-miR-548ak (RPM: 0.0892) / hsa-miR-4735-5p (RPM: 0.022) / hsa-miR-378h (RPM: 0.0206) / hsa-miR-4435 (RPM: 1.1176) / hsa-miR-378d (RPM: 8.7748) / hsa-miR-196b-5p (RPM: 0.2478) / hsa-miR-378e (RPM: 0.1206) / hsa-miR-4701-5p (RPM: 0.05) / hsa-miR-5682 (RPM: 0.013) / hsa-miR-548aq-5p (RPM: 0.0114) / hsa-miR-4726-3p (RPM: 0.0088) / hsa-miR-618 (RPM: 4.5528) / hsa-miR-1243 (RPM: 0.1858) / hsa-miR-224-5p (RPM: 33.3102) / hsa-miR-629-3p (RPM: 0.715) / hsa-miR-4799-3p (RPM: 0.01) / hsa-miR-4766-3p (RPM: 0.011) / hsa-miR-4781-3p (RPM: 1.0594) / hsa-miR-422a (RPM: 0.3564) / hsa-miR-337-3p (RPM: 2.4246) / hsa-miR-196a-5p (RPM: 0.311) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-192-5p (RPM: 3146.8498) / hsa-miR-4799-5p (RPM: 0.0586) / hsa-miR-193b-5p (RPM: 3.2336) / hsa-miR-590-5p (RPM: 0.1536) / hsa-miR-125a-3p (RPM: 24.5112) / hsa-miR-4716-5p (RPM: 0.001) / hsa-miR-3663-5p (RPM: 0.0058) / hsa-miR-186-3p (RPM: 0.0884) / hsa-miR-4720-5p (RPM: 0.0106) / hsa-miR-3170 (RPM: 0.0078) / hsa-miR-5588-5p (RPM: 0.198) / hsa-miR-378i (RPM: 9.2716) / hsa-miR-888-3p (RPM: 0.0024) / hsa-miR-218-5p (RPM: 36.775) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-95-5p (RPM: 0.9772) / hsa-miR-6131 (RPM: 0.0044) / hsa-miR-6882-5p (RPM: 0.543) / hsa-miR-548ay-5p (RPM: 0.357) / hsa-miR-548bb-5p (RPM: 0.0048) / hsa-miR-548ad-5p (RPM: 0.3028) / hsa-miR-548ae-5p (RPM: 1.1262) / hsa-miR-7705 (RPM: 0.6122) / hsa-miR-6821-3p (RPM: 0.0074) / hsa-miR-6855-5p (RPM: 0.0636) / hsa-miR-6790-3p (RPM: 0.0104) / hsa-miR-7158-3p (RPM: 1.0142) / hsa-miR-6742-5p (RPM: 0.0052) / hsa-miR-6757-3p (RPM: 0.109) /
Involved Diseases
Volkmann cataract /
Involved Pathways
Metabolic pathways / Pantothenate and CoA biosynthesis /
Sequence
ATGGTTGAGCTCATGTTCCCGCTGTTGCTCCTCCTTCTGCCCTTCCTTCTGTATATGGCTGCGCCCCAAATCAGGAAAATGCTGTCCAGTGGGGTGTGTACATCAACTGTTCAGCTTCCTGGGAAAGTAGTTGTGGTCACAGGAGCTAATACAGGTATCGGGAAGGAGACAGCCAAAGAGCTGGCTCAGAGAGGAGCTCGAGTATATTTAGCTTGCCGGGATGTGGAAAAGGGGGAATTGGTGGCCAAAGAGATCCAGACCACGACAGGGAACCAGCAGGTGTTGGTGCGGAAACTGGACCTGTCTGATACTAAGTCTATTCGAGCTTTTGCTAAGGGCTTCTTAGCTGAGGAAAAGCACCTCCACGTTTTGATCAACAATGCAGGAGTGATGATGTGTCCGTACTCGAAGACAGCAGATGGCTTTGAGATGCACATAGGAGTCAACCACTTGGGTCACTTCCTCCTAACCCATCTGCTGCTAGAGAAACTAAAGGAATCAGCCCCATCAAGGATAGTAAATGTGTCTTCCCTCGCACATCACCTGGGAAGGATCCACTTCCATAACCTGCAGGGCGAGAAATTCTACAATGCAGGCCTGGCCTACTGTCACAGCAAGCTAGCCAACATCCTCTTCACCCAGGAACTGGCCCGGAGACTAAAAGGCTCTGGCGTTACGACGTATTCTGTACACCCTGGCACAGTCCAATCTGAACTGGTTCGGCACTCATCTTTCATGAGATGGATGTGGTGGCTTTTCTCCTTTTTCATCAAGACTCCTCAGCAGGGAGCCCAGACCAGCCTGCACTGTGCCTTAACAGAAGGTCTTGAGATTCTAAGTGGGAATCATTTCAGTGACTGTCATGTGGCATGGGTCTCTGCCCAAGCTCGTAATGAGACTATAGCAAGGCGGCTGTGGGACGTCAGTTGTGACCTGCTGGGCCTCCCAATAGACTAA

Back to List