Details for gene: YAP1


protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; cellular response to DNA damage stimulus : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating damage to its DNA from environmental insults or errors during metabolism. ; negative regulation of transcription by RNA polymerase II : Any process that stops, prevents, or reduces the frequency, rate or extent of transcription mediated by RNA polymerase II. ; transcription coactivator activity : A transcription coregulator activity that activates or increases the transcription of specific gene sets via binding to a DNA-bound DNA-binding transcription factor, either on its own or as part of a complex. Coactivators often act by altering chromatin structure and modifications. For example, one class of transcription coactivators modifies chromatin structure through covalent modification of histones. A second class remodels the conformation of chromatin in an ATP-dependent fashion. A third class modulates interactions of DNA-bound DNA-binding transcription factors with other transcription coregulators. A fourth class of coactivator activity is the bridging of a DNA-binding transcription factor to the general (basal) transcription machinery. The Mediator complex, which bridges sequence-specific DNA binding transcription factors and RNA polymerase, is also a transcription coactivator. ; transcription cis-regulatory region binding : Interacting selectively and non-covalently with a specific sequence of DNA that is part of a regulatory region that controls transcription of that section of the DNA. The transcribed region might be described as a gene, cistron, or operon. ; transcription corepressor activity : A transcription coregulator activity that represses or decreases the transcription of specific gene sets via binding to a DNA-bound DNA-binding transcription factor, either on its own or as part of a complex. Corepressors often act by altering chromatin structure and modifications. For example, one class of transcription corepressors modifies chromatin structure through covalent modification of histones. A second class remodels the conformation of chromatin in an ATP-dependent fashion. A third class modulates interactions of DNA-bound DNA-binding transcription factors with other transcription coregulators. ; hippo signaling : The series of molecular signals mediated by the serine/threonine kinase Hippo or one of its orthologs. In Drosophila, Hippo in complex with the scaffold protein Salvador (Sav), phosphorylates and activates Warts (Wts), which in turn phosphorylates and inactivates the Yorkie (Yki) transcriptional activator. The core fly components hippo, sav, wts and mats are conserved in mammals as STK4/3 (MST1/2), SAV1/WW45, LATS1/2 and MOB1. ; nucleoplasm : That part of the nuclear content other than the chromosomes or the nucleolus. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; positive regulation of transcription by RNA polymerase II : Any process that activates or increases the frequency, rate or extent of transcription from an RNA polymerase II promoter. ; positive regulation of gene expression : Any process that increases the frequency, rate or extent of gene expression. Gene expression is the process in which a gene's coding sequence is converted into a mature gene product or products (proteins or RNA). This includes the production of an RNA transcript as well as any processing to produce a mature RNA product or an mRNA or circRNA (for protein-coding genes) and the translation of that mRNA or circRNA into protein. Protein maturation is included when required to form an active form of a product from an inactive precursor form. ; positive regulation of Notch signaling pathway : Any process that activates or increases the frequency, rate or extent of the Notch signaling pathway. ; positive regulation of intracellular estrogen receptor signaling pathway : Any process that activates or increases the frequency, rate or extent of the activity of an intracellular estrogen receptor signaling pathway. ; positive regulation of transcription, DNA-templated : Any process that activates or increases the frequency, rate or extent of cellular DNA-templated transcription. ; negative regulation of cilium assembly : Any process that stops, prevents or reduces the frequency, rate or extent of cilium assembly. ; cell population proliferation : The multiplication or reproduction of cells, resulting in the expansion of a cell population. ; interleukin-6-mediated signaling pathway : A series of molecular signals initiated by the binding of interleukin-6 to a receptor on the surface of a cell, and ending with regulation of a downstream cellular process, e.g. transcription. ; negative regulation of fat cell differentiation : Any process that stops, prevents, or reduces the frequency, rate or extent of adipocyte differentiation. ; positive regulation of osteoblast differentiation : Any process that activates or increases the frequency, rate or extent of osteoblast differentiation. ; DNA-binding transcription factor binding : Interacting selectively and non-covalently with a DNA-binding transcription factor, a protein that interacts with a specific DNA sequence (sometimes referred to as a motif) within the regulatory region of a gene to modulate transcription. ; positive regulation of protein localization to nucleus : Any process that activates or increases the frequency, rate or extent of protein localization to nucleus. ; response to progesterone : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a progesterone stimulus. ; intestinal epithelial cell development : The process whose specific outcome is the progression of a columnar/cuboidal epithelial cell of the intestine over time, from its formation to the mature structure. ; cellular response to gamma radiation : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a gamma radiation stimulus. Gamma radiation is a form of electromagnetic radiation (EMR) or light emission of a specific frequency produced from sub-atomic particle interaction, such as electron-positron annihilation and radioactive decay. Gamma rays are generally characterized as EMR having the highest frequency and energy, and also the shortest wavelength, within the electromagnetic radiation spectrum. ; negative regulation of gene expression : Any process that decreases the frequency, rate or extent of gene expression. Gene expression is the process in which a gene's coding sequence is converted into a mature gene product or products (proteins or RNA). This includes the production of an RNA transcript as well as any processing to produce a mature RNA product or an mRNA or circRNA (for protein-coding genes) and the translation of that mRNA or circRNA into protein. Protein maturation is included when required to form an active form of a product from an inactive precursor form. ; protein-containing complex assembly : The aggregation, arrangement and bonding together of a set of macromolecules to form a protein-containing complex. ; TEAD-YAP complex : A transcription factor complex that is composed of the one DNA binding protein of the TEAD family and the transcriptional coactivator YAP. ; regulation of neurogenesis : Any process that modulates the frequency, rate or extent of neurogenesis, the generation of cells in the nervous system. ; regulation of stem cell proliferation : Any process that modulates the frequency, rate or extent of stem cell proliferation. A stem cell is a cell that retains the ability to divide and proliferate throughout life to provide progenitor cells that can differentiate into specialized cells. ; positive regulation of epithelial cell proliferation : Any process that activates or increases the rate or extent of epithelial cell proliferation. ; progesterone receptor signaling pathway : Any series of molecular signals generated as a consequence of a progesterone binding to its receptor. ; contact inhibition : The series of events in which information about the density of cells in a population is received by direct cell-cell contact and is converted into a molecular signal, resulting in the cessation of cell growth or proliferation. ; negative regulation of epithelial cell apoptotic process : Any process that stops, prevents or reduces the frequency, rate or extent of epithelial cell apoptotic process. ; RNA polymerase II cis-regulatory region sequence-specific DNA binding : Interacting selectively and non-covalently with a specific upstream regulatory DNA sequence (transcription factor recognition sequence or binding site) located in cis relative to the transcription start site (i.e., on the same strand of DNA) of a gene transcribed by RNA polymerase II. ; chromatin binding : Interacting selectively and non-covalently with chromatin, the network of fibers of DNA, protein, and sometimes RNA, that make up the chromosomes of the eukaryotic nucleus during interphase. ; protein C-terminus binding : Interacting selectively and non-covalently with a protein C-terminus, the end of any peptide chain at which the 1-carboxyl function of a constituent amino acid is not attached in peptide linkage to another amino-acid residue. ; proline-rich region binding : Interacting selectively and non-covalently with a proline-rich region, i.e. a region that contains a high proportion of proline residues, in a protein. ; cell morphogenesis : The developmental process in which the size or shape of a cell is generated and organized. ; vasculogenesis : The differentiation of endothelial cells from progenitor cells during blood vessel development, and the de novo formation of blood vessels and tubes. ; blastocyst development : The process whose specific outcome is the progression of the blastocyst over time, from its formation to the mature structure. The mammalian blastocyst is a hollow ball of cells containing two cell types, the inner cell mass and the trophectoderm. ; trophectodermal cell differentiation : The process in which a relatively unspecialized cell acquires the specialized features of a trophectoderm cell. ; tissue homeostasis : A homeostatic process involved in the maintenance of an internal steady state within a defined tissue of an organism, including control of cellular proliferation and death and control of metabolic function. ; heart process : A circulatory system process carried out by the heart. The heart is a hollow, muscular organ, which, by contracting rhythmically, keeps up the circulation of the blood. The heart is a hollow, muscular organ, which, by contracting rhythmically, keeps up the circulation of the blood. ; embryonic heart tube morphogenesis : The process in which the anatomical structures of the embryonic heart tube are generated and organized. The embryonic heart tube is an epithelial tube that will give rise to the mature heart. ; positive regulation of cell population proliferation : Any process that activates or increases the rate or extent of cell proliferation. ; regulation of gene expression : Any process that modulates the frequency, rate or extent of gene expression. Gene expression is the process in which a gene's coding sequence is converted into a mature gene product or products (proteins or RNA). This includes the production of an RNA transcript as well as any processing to produce a mature RNA product or an mRNA or circRNA (for protein-coding genes) and the translation of that mRNA or circRNA into protein. Protein maturation is included when required to form an active form of a product from an inactive precursor form. ; regulation of keratinocyte proliferation : Any process that modulates the rate, frequency or extent of keratinocyte proliferation. Keratinocyte proliferation is the multiplication or reproduction of keratinocytes, resulting in the expansion of a cell population. ; keratinocyte differentiation : The process in which a relatively unspecialized cell acquires specialized features of a keratinocyte. ; negative regulation of epithelial cell differentiation : Any process that stops, prevents, or reduces the frequency, rate or extent of epithelial cell differentiation. ; notochord development : The process whose specific outcome is the progression of the notochord over time, from its formation to the mature structure. The notochord is a mesoderm-derived structure located ventral of the developing nerve cord. In vertebrates, the notochord serves as a core around which other mesodermal cells form the vertebrae. In the most primitive chordates, which lack vertebrae, the notochord persists as a substitute for a vertebral column. ; somatic stem cell population maintenance : Any process by which an organism retains a population of somatic stem cells, undifferentiated cells in the embryo or adult which can undergo unlimited division and give rise to cell types of the body other than those of the germ-line. ; wound healing : The series of events that restore integrity to a damaged tissue, following an injury. ; regulation of cell population proliferation : Any process that modulates the frequency, rate or extent of cell proliferation. ; positive regulation of organ growth : Any process that activates or increases the frequency, rate or extent of growth of an organ of an organism. ; paraxial mesoderm development : The process whose specific outcome is the progression of the paraxial mesoderm over time, from its formation to the mature structure. The paraxial mesoderm is the mesoderm located bilaterally adjacent to the notochord and neural tube. ; lateral mesoderm development : The process whose specific outcome is the progression of the lateral mesoderm over time, from its formation to the mature structure. ; positive regulation of cardiac muscle cell proliferation : Any process that activates or increases the frequency, rate or extent of cardiac muscle cell proliferation. ; bud elongation involved in lung branching : The process in which a bud in the lung grows out from the point where it is formed. ; lung epithelial cell differentiation : The process in which a relatively unspecialized cell acquires specialized features of an epithelial cell that contributes to the epithelium of the lung. ; regulation of canonical Wnt signaling pathway : Any process that modulates the rate, frequency, or extent of the Wnt signaling pathway through beta-catenin, the series of molecular signals initiated by binding of a Wnt protein to a frizzled family receptor on the surface of the target cell, followed by propagation of the signal via beta-catenin, and ending with a change in transcription of target genes. ; cardiac muscle tissue regeneration : The regrowth of cardiac muscle tissue to repair injured or damaged muscle fibers in the postnatal stage. ; cellular response to retinoic acid : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a retinoic acid stimulus. ; regulation of metanephric nephron tubule epithelial cell differentiation : Any process that modulates the frequency, rate or extent of metanephric nephron tubule epithelial cell differentiation. ; positive regulation of canonical Wnt signaling pathway : Any process that increases the rate, frequency, or extent of the Wnt signaling pathway through beta-catenin, the series of molecular signals initiated by binding of a Wnt protein to a frizzled family receptor on the surface of the target cell, followed by propagation of the signal via beta-catenin, and ending with a change in transcription of target genes. ; positive regulation of stem cell population maintenance : Any process that activates or increases the frequency, rate or extent of stem cell population maintenance. ; negative regulation of stem cell differentiation : Any process that stops, prevents or reduces the frequency, rate or extent of stem cell differentiation. ; negative regulation of extrinsic apoptotic signaling pathway : Any process that stops, prevents or reduces the frequency, rate or extent of extrinsic apoptotic signaling pathway. ; female germ cell nucleus : The nucleus of the female germ cell, a reproductive cell in females. ; transcription regulator complex : A protein complex that is capable of associating with DNA by direct binding, or via other DNA-binding proteins or complexes, and regulating transcription. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; : ;


Symbol
YAP1
Name
Yes1 associated transcriptional regulator
Entrez ID
10413
Ensembl ID
ENSG00000137693    (more details)
KEGG ID
hsa:10413    (more details)
OMIM ID
120433
Uniprot ID
P46937  
GO ID
hsa:10413    (more details)
Chromosome
19
Strand
1
Start
37907208
End
38208369
miRNA Interactions
hsa-miR-15a-5p (RPM: 139.425) / hsa-miR-212-3p (RPM: 7.7608) / hsa-miR-141-3p (RPM: 2843.5066) / hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-132-3p (RPM: 82.2598) / hsa-miR-15b-5p (RPM: 133.5752) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-200a-3p (RPM: 157.5826) / hsa-miR-424-5p (RPM: 9.04) / hsa-miR-27b-3p (RPM: 22876.2392) / hsa-miR-506-3p (RPM: 0.6452) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-101-3p (RPM: 3335.0564) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-205-5p (RPM: 5027.3352) / hsa-miR-106a-5p (RPM: 7.9736) / hsa-miR-183-5p (RPM: 37556.6894) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-335-3p (RPM: 837.9252) / hsa-miR-450b-5p (RPM: 4.6184) / hsa-miR-19b-3p (RPM: 197.0578) / hsa-miR-19a-3p (RPM: 25.4064) / hsa-miR-544a (RPM: 0.082) / hsa-miR-497-5p (RPM: 49.4968) / hsa-miR-125b-5p (RPM: 10044.3546) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-138-5p (RPM: 67.2828) / hsa-miR-513a-5p (RPM: 0.3656) / hsa-miR-129-5p (RPM: 135.1492) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-let-7f-5p (RPM: 17066.6836) / hsa-let-7c-5p (RPM: 4028.6728) / hsa-miR-125a-5p (RPM: 11539.4616) / hsa-miR-612 (RPM: 0.0216) / hsa-miR-548av-5p (RPM: 0.007) / hsa-miR-199b-5p (RPM: 234.7942) / hsa-miR-548o-3p (RPM: 3.2198) / hsa-let-7i-5p (RPM: 2025.2084) / hsa-miR-98-5p (RPM: 1660.0964) / hsa-let-7e-5p (RPM: 3790.2074) / hsa-let-7g-5p (RPM: 3559.4376) / hsa-miR-607 (RPM: 0.001) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-30e-3p (RPM: 538.304) / hsa-miR-30a-3p (RPM: 889.1386) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-miR-484 (RPM: 434.5276) / hsa-miR-509-3p (RPM: 31.2006) / hsa-miR-3121-3p (RPM: 0.036) / hsa-miR-548k (RPM: 8.758) / hsa-miR-448 (RPM: 1.696) / hsa-let-7b-3p (RPM: 92.0818) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-1305 (RPM: 0.128) / hsa-miR-187-5p (RPM: 0.2682) / hsa-miR-194-5p (RPM: 48.9448) / hsa-miR-548p (RPM: 1.2822) / hsa-miR-10a-3p (RPM: 0.0878) / hsa-miR-375-3p (RPM: 82.702) / hsa-miR-4729 (RPM: 0.049) / hsa-miR-214-3p (RPM: 21.2784) / hsa-miR-545-5p (RPM: 0.3484) / hsa-miR-136-5p (RPM: 38.7962) / hsa-miR-204-5p (RPM: 265062.0076) / hsa-miR-199a-5p (RPM: 174.3046) / hsa-miR-21-5p (RPM: 5494.851) / hsa-miR-203a-3p (RPM: 1346.5646) / hsa-let-7d-5p (RPM: 1078.3154) / hsa-miR-181d-5p (RPM: 168.2728) / hsa-miR-22-3p (RPM: 26348.475) / hsa-miR-181b-5p (RPM: 3069.8278) / hsa-miR-548l (RPM: 0.078) / hsa-miR-138-2-3p (RPM: 0.1862) / hsa-miR-181c-5p (RPM: 1285.07) / hsa-miR-181a-5p (RPM: 52364.6344) / hsa-miR-548d-5p (RPM: 1.1692) / hsa-miR-548a-5p (RPM: 0.0098) / hsa-miR-548i (RPM: 1.7968) / hsa-miR-548ar-5p (RPM: 0.0164) / hsa-miR-548ap-5p (RPM: 0.0048) / hsa-miR-548au-5p (RPM: 0.1902) / hsa-miR-139-5p (RPM: 36.887) / hsa-miR-21-3p (RPM: 238.3548) / hsa-miR-548as-5p (RPM: 0.0316) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-548c-5p (RPM: 0.235) / hsa-miR-548b-5p (RPM: 0.2842) / hsa-miR-548am-5p (RPM: 0.2292) / hsa-miR-548o-5p (RPM: 0.235) / hsa-miR-548ab (RPM: 0.3238) / hsa-miR-548y (RPM: 0.046) / hsa-miR-548h-5p (RPM: 0.3692) / hsa-miR-499a-3p (RPM: 0.2716) / hsa-miR-548j-5p (RPM: 0.0632) / hsa-miR-4733-5p (RPM: 0.1604) / hsa-miR-378a-3p (RPM: 1540.7796) / hsa-let-7g-3p (RPM: 7.0448) / hsa-miR-548w (RPM: 0.4064) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-199a-3p (RPM: 731.3038) / hsa-miR-548ak (RPM: 0.0892) / hsa-miR-299-5p (RPM: 2.2688) / hsa-miR-548aq-5p (RPM: 0.0114) / hsa-miR-202-5p (RPM: 0.3964) / hsa-miR-4639-5p (RPM: 0.049) / hsa-miR-744-3p (RPM: 3.4814) / hsa-miR-665 (RPM: 0.445) / hsa-miR-422a (RPM: 0.3564) / hsa-miR-574-5p (RPM: 176.4618) / hsa-miR-630 (RPM: 0.0014) / hsa-miR-361-3p (RPM: 73.5598) / hsa-miR-330-3p (RPM: 21.3424) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-96-3p (RPM: 0.9616) / hsa-miR-181a-2-3p (RPM: 1451.5764) / hsa-miR-3125 (RPM: 1.2126) / hsa-miR-3916 (RPM: 0.1044) / hsa-miR-877-5p (RPM: 44.6348) / hsa-miR-424-3p (RPM: 2.2264) / hsa-miR-27a-5p (RPM: 7.3838) / hsa-miR-3159 (RPM: 0.2288) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-339-3p (RPM: 185.7798) / hsa-miR-191-5p (RPM: 12993.8088) / hsa-miR-483-5p (RPM: 0.9526) / hsa-miR-652-3p (RPM: 178.199) / hsa-miR-1468-3p (RPM: 0.0042) / hsa-miR-6844 (RPM: 0.005) / hsa-miR-548ay-5p (RPM: 0.357) / hsa-miR-548bb-5p (RPM: 0.0048) / hsa-miR-548ad-5p (RPM: 0.3028) / hsa-miR-548ae-5p (RPM: 1.1262) / hsa-miR-6859-5p (RPM: 0.856) /
Involved Diseases
Volkmann cataract /
Involved Pathways
Sequence
ATGGATCCCGGGCAGCAGCCGCCGCCTCAACCGGCCCCCCAGGGCCAAGGGCAGCCGCCTTCGCAGCCCCCGCAGGGGCAGGGCCCGCCGTCCGGACCCGGGCAACCGGCACCCGCGGCGACCCAGGCGGCGCCGCAGGCACCCCCCGCCGGGCATCAGATCGTGCACGTCCGCGGGGACTCGGAGACCGACCTGGAGGCGCTCTTCAACGCCGTCATGAACCCCAAGACGGCCAACGTGCCCCAGACCGTGCCCATGAGGCTCCGGAAGCTGCCCGACTCCTTCTTCAAGCCGCCGGAGCCCAAATCCCACTCCCGACAGGCCAGTACTGATGCAGGCACTGCAGGAGCCCTGACTCCACAGCATGTTCGAGCTCATTCCTCTCCAGCTTCTCTGCAGTTGGGAGCTGTTTCTCCTGGGACACTGACCCCCACTGGAGTAGTCTCTGGCCCAGCAGCTACACCCACAGCTCAGCATCTTCGACAGTCTTCTTTTGAGATACCTGATGATGTACCTCTGCCAGCAGGTTGGGAGATGGCAAAGACATCTTCTGGTCAGAGATACTTCTTAAATCACATCGATCAGACAACAACATGGCAGGACCCCAGGAAGGCCATGCTGTCCCAGATGAACGTCACAGCCCCCACCAGTCCACCAGTGCAGCAGAATATGATGAACTCGGCTTCAGGTCCTCTTCCTGATGGATGGGAACAAGCCATGACTCAGGATGGAGAAATTTACTATATAAACCATAAGAACAAGACCACCTCTTGGCTAGACCCAAGGCTTGACCCTCGTTTTGCCATGAACCAGAGAATCAGTCAGAGTGCTCCAGTGAAACAGCCACCACCCCTGGCTCCCCAGAGCCCACAGGGAGGCGTCATGGGTGGCAGCAACTCCAACCAGCAGCAACAGATGCGACTGCAGCAACTGCAGATGGAGAAGGAGAGGCTGCGGCTGAAACAGCAAGAACTGCTTCGGCAGGCAATGCGGAATATCAATCCCAGCACAGCAAATTCTCCAAAATGTCAGGAGTTAGCCCTGCGTAGCCAGTTACCAACACTGGAGCAGGATGGTGGGACTCAAAATCCAGTGTCTTCTCCCGGGATGTCTCAGGAATTGAGAACAATGACGACCAATAGCTCAGATCCTTTCCTTAACAGTGGCACCTATCACTCTCGAGATGAGAGTACAGACAGTGGACTAAGCATGAGCAGCTACAGTGTCCCTCGAACCCCAGATGACTTCCTGAACAGTGTGGATGAGATGGATACAGGTGATACTATCAACCAAAGCACCCTGCCCTCACAGCAGAACCGTTTCCCAGACTACCTTGAAGCCATTCCTGGGACAAATGTGGACCTTGGAACACTGGAAGGAGATGGAATGAACATAGAAGGAGAGGAGCTGATGCCAAGTCTGCAGGAAGCTTTGAGTTCTGACATCCTTAATGACATGGAGTCTGTTTTGGCTGCCACCAAGCTAGATAAAGAAAGCTTTCTTACATGGTTATAG

Back to List