Details for gene: HMX1


DNA binding : Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid). ; regulation of transcription, DNA-templated : Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription. ; DNA-binding transcription factor activity, RNA polymerase II-specific : A DNA-binding transcription factor activity that modulates the transcription of specific gene sets transcribed by RNA polymerase II. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; negative regulation of transcription, DNA-templated : Any process that stops, prevents, or reduces the frequency, rate or extent of cellular DNA-templated transcription. ; regulation of transcription by RNA polymerase II : Any process that modulates the frequency, rate or extent of transcription mediated by RNA polymerase II. ; RNA polymerase II transcription regulatory region sequence-specific DNA binding : Interacting selectively and non-covalently with a specific sequence of DNA that is part of a regulatory region that controls the transcription of a gene or cistron by RNA polymerase II. ; chromatin : The ordered and organized complex of DNA, protein, and sometimes RNA, that forms the chromosome. ; sequence-specific double-stranded DNA binding : Interacting selectively and non-covalently with double-stranded DNA of a specific nucleotide composition, e.g. GC-rich DNA binding, or with a specific sequence motif or type of DNA, e.g. promotor binding or rDNA binding. ; DNA-binding transcription repressor activity, RNA polymerase II-specific : A DNA-binding transcription factor activity that represses or decreases the transcription of specific gene sets transcribed by RNA polymerase II. ; negative regulation of transcription by RNA polymerase II : Any process that stops, prevents, or reduces the frequency, rate or extent of transcription mediated by RNA polymerase II. ;


Symbol
HMX1
Name
H6 family homeobox 1
Entrez ID
3166
Ensembl ID
ENSG00000215612    (more details)
KEGG ID
hsa:3166    (more details)
OMIM ID
142992
Uniprot ID
F1T0J4  
GO ID
hsa:3166    (more details)
Chromosome
10
Strand
-1
Start
89430299
End
89556641
miRNA Interactions
hsa-miR-765 (RPM: 0.4272) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-4779 (RPM: 0.024) / hsa-miR-766-5p (RPM: 0.1124) / hsa-miR-939-5p (RPM: 0.5712) / hsa-miR-204-5p (RPM: 265062.0076) / hsa-miR-211-5p (RPM: 11706.6776) / hsa-miR-4254 (RPM: 0.0334) / hsa-miR-4448 (RPM: 1.2208) / hsa-miR-3690 (RPM: 0.2136) / hsa-miR-363-5p (RPM: 0.4074) / hsa-miR-3195 (RPM: 0.0682) / hsa-miR-3141 (RPM: 0.2864) / hsa-miR-6880-5p (RPM: 0.1286) / hsa-miR-6772-3p (RPM: 1.3658) / hsa-miR-6745 (RPM: 0.0012) / hsa-miR-7847-3p (RPM: 0.0118) / hsa-miR-1343-5p (RPM: 0.0198) / hsa-miR-6777-5p (RPM: 0.557) / hsa-miR-6889-5p (RPM: 0.041) / hsa-miR-6827-5p (RPM: 0.0828) / hsa-miR-6894-5p (RPM: 0.2296) / hsa-miR-1180-5p (RPM: 0.7592) / hsa-miR-7114-3p (RPM: 0.4282) /
Involved Diseases
Volkmann cataract /
Involved Pathways
Hippo signaling pathway /
Sequence
ATGCCTGACGAGCTGACGGAGCCCGGGCGCGCCACGCCGGCCCGCGCCTCCTCCTTCCTCATCGAGAACCTGCTGGCGGCCGAGGCCAAGGGCGCAGGGCGCGCGACCCAGGGCGACGGCAGCCGGGAGGACGAGGAGGAGGACGACGACGACCCCGAAGACGAGGACGCCGAGCAGGCGCGGCGGCGACGGCTACAGCGGCGGCGACAGTTGCTCGCGGGCACCGGGCCCGGCGGGGAGGCGCGGGCCCGTGCGCTGCTCGGGCCGGGCGCGCTGGGCCTCGGTCCTCGGCCGCCCCCCGGTCCCGGGCCGCCCTTCGCTCTGGGCTGCGGAGGCGCAGCGCGCTGGTACCCACGGGCGCACGGTGGCTATGGAGGCGGCCTCAGTCCTGACACCAGCGACCGGGACTCACCGGAGACGGGCGAGGAGATGGGCCGTGCGGAGGGCGCCTGGCCGCGAGGCCCCGGGCCGGGAGCGGTGCAGCGGGAGGCAGCGGAGCTGGCGGCGCGTGGCCCGGCGGCCGGCACGGAGGAGGCGTCGGAGCTGGCCGAGGTCCCTGCGGCGGCTGGGGAGACACGCGGCGGCGTTGGCGTGGGCGGCGGCCGAAAGAAGAAGACGCGCACAGTCTTCTCCCGCAGCCAGGTCTTCCAGCTGGAATCCACCTTCGACCTGAAGCGCTACCTGAGCAGCGCCGAGCGCGCCGGCCTGGCCGCCTCCCTGCAGCTCACCGAGACGCAGGTTAAGATCTGGTTCCAGAACCGCCGCAACAAGTGGAAGCGGCAGCTGGCAGCCGAGCTGGAGGCGGCCAGCCTGTCCCCGCCGGGAGCGCAGCGCCTGGTCCGCGTGCCGGTGCTCTACCACGAAAGCCCCCCGGCCGCAGCCGCCGCTGGGCCCCCGGCCACCCTGCCCTTCCCGCTGGCGCCCGCCGCGCCCGCGCCGCCCCCACCGCTGCTCGGCTTCTCCGGGGCCCTCGCCTACCCGCTGGCCGCCTTCCCGGCCGCCGCCTCCGTGCCCTTTCTGCGGGCGCAGATGCCTGGCCTGGTGTGA

Back to List