Details for gene: SIX6


The protein encoded by this gene is a homeobox protein that is similar to the Drosophila 'sine oculis' gene product. This gene is found in a cluster of related genes on chromosome 14 and is thought to be involved in eye development. Defects in this gene are a cause of isolated microphthalmia with cataract type 2 (MCOPCT2). [provided by RefSeq, Jul 2008]


Symbol
SIX6
Name
SIX homeobox 6
Entrez ID
4990
Ensembl ID
ENSG00000184302    (more details)
KEGG ID
hsa:4990    (more details)
OMIM ID
606326
Uniprot ID
Q6P051  
GO ID
hsa:4990    (more details)
Chromosome
14
Strand
1
Start
60509146
End
60512850
miRNA Interactions
hsa-miR-579-3p (RPM: 0.0084) / hsa-miR-664b-3p (RPM: 4.7274) / hsa-miR-181a-5p (RPM: 52364.6344) / hsa-miR-130b-5p (RPM: 60.0122) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-933 (RPM: 0.2104) / hsa-miR-6875-3p (RPM: 0.0698) / hsa-miR-153-5p (RPM: 0.2042) / hsa-miR-6826-3p (RPM: 0.0176) / hsa-miR-6511b-5p (RPM: 0.4736) / hsa-miR-6811-5p (RPM: 0.1382) / hsa-miR-6516-5p (RPM: 0.859) / hsa-miR-6895-3p (RPM: 0.15) / hsa-miR-6887-3p (RPM: 0.0038) / hsa-miR-6870-3p (RPM: 0.0056) / hsa-miR-6795-3p (RPM: 0.0024) /
Involved Diseases
myopia /
Involved Pathways
Sequence
AATAGCGGAGCCAGCTCGCCTGCCGGCGTGCCTGAGCCGAGCCGAGCCCGAACCCCAAGCCGCGGAGCCAGCACCTCCTCCAGTCGGGGTCGTCCGCTCCCGGCCGTTGAGCCACCGCCGCCACCCGGTAGTGTGTCCCGCTGCCCCAATCCGCCTCATCAACAAGCGCCTGGCACACTCAGCCAGGCCCGCGGGCATCTGCTGCGTGTCCCGCTCCGGGCTCAGTGCCCTCGCCGCCGCCGGCACTGCCTCGATGTTCCAGCTGCCCATCTTGAATTTCAGCCCCCAGCAAGTGGCCGGGGTATGTGAGACCCTGGAAGAGAGCGGCGATGTGGAGCGCCTGGGTCGCTTCCTCTGGTCGCTGCCCGTGGCCCCTGCGGCCTGCGAGGCCCTCAACAAGAATGAGTCGGTGCTACGCGCACGAGCCATCGTGGCCTTTCACGGTGGCAACTACCGCGAGCTCTATCATATCCTGGAAAACCACAAGTTCACCAAGGAGTCGCACGCCAAGCTGCAGGCGCTGTGGCTTGAAGCACACTACCAGGAGGCTGAGAAGCTGCGTGGAAGACCCCTGGGACCTGTGGACAAGTACCGAGTAAGGAAGAAGTTCCCGCTGCCGCGCACCATTTGGGACGGCGAACAGAAGACACACTGCTTCAAGGAGCGCACGCGGCACCTGCTACGCGAGTGGTACCTGCAGGATCCATACCCTAACCCCAGCAAAAAACGTGAGCTCGCCCAGGCAACCGGACTGACCCCTACGCAGGTGGGCAACTGGTTCAAAAACCGCCGACAAAGGGACCGAGCGGCTGCAGCCAAGAACAGGTCGGTACCTAGAGGCCTCCGCGCTTTGAGCGCACCGGGGAGGAGGCGGGTGGAGGCACCTCTGGCGCCCTTACCCAGTCCCTGGCGACTCCAATTCAGCAGGAGTTGGGAGCGCGGTCTGTCTTGGGTTAAGAGCCCTGCGTTCTGGGCTCCTGGCCGGGAGTTCCCTTGCCGGCTCTGCTTCCCCACCCGCTGGCTCCCCACGCCTGCGGGCAGCTGCAGCAGCTGGTCCCGGTCACCAAACCAAGGCTTCACTGGGACGGAGAGGGGAAGAGAAATAAAAAATTAAAATCCTACAAACAGTTAGGGACCCCAAGACCCAAAGCTAATTCTTGTCAGCCTGGGCACAGGCTCCTACTATTAATCGAAGCCTGGCTTATTAGCAATGTGTCGGTTTCATGTTAATTATCATTTTCAAAGCCCAGGTATATCCCTCCCTAATGCTTTGAAAACAGTTTTCAATGGACTTTTGAGAAATGGGAAGTCGAGTTTTCCTCTTCCCATGCGCTGCCTGCCACTCTTGTCTCAAAACAGCAAACTAGTCCGTGGGCCGAGGCTTTTCGTTTCCCGGAGTGTGGATCTCGATTAGCCAAACATTTTGCGGAAGAGCCCGGCCTCATCCCCCAGGCCCAAATGCTCCTTACAATCCTTTTTGCCTTTAGGTCGGGCCGACCCGATCCAACGCGATCGCGGGAGCACTTGCTCAGGCGTAAGCCCCAGGCAGACGCACCGTTAGAAATGGTATCCCATGTCCCTGGGACCGATCTGTCCTTGTCACCCACACTTCGTTTATTTCCTGACAGTCCTGTAAATCTCCCAAAAGTGCACAACAAACAGGGAGGACACTGCAAGCCCAGTATATAAAAGACCTGGGAGCTGCGGCGCTGAGAAAGGGCGCGAATCATGGTGGGGCACAACAGTAGGGACCCGCGGAGGGGCGGCCGCGGACTCCTGCCCGACCTCTGTCGCCTTGCCGAGTAATCCTCGCCTTAACTGCTGGGGTCTTCGGAAGAACCTCTAGCCGCCGGGCTGGAGGGACGCAGGAGGTGGTGGGGGCGGGCGACGGGCGGCTGTGTTACGAGCTGTGACCCGTGTTCCCTTTCTTCCCCGTAGACTCCAGCAGCAGGTCCTGTCACAGGGTTCCGGGCGGGCACTACGGGCGGAGGGCGACGGCACGCCAGAGGTGCTGGGCGTCGCCACCAGCCCGGCCGCCAGTCTATCCAGCAAGGCGGCCACTTCAGCCATCTCCATCACGTCCAGCGACAGCGAGTGCGACATCTGAGTTGCCCATCCAGGATGCTCAGAAGCAGATTCCAGTGTAAAAACGAGAAAAACAAAATGAAAGAGGGGAAGAAGATGAGAGACCTGCAAATCCAGCGCCACAGAAGCCAGGTGACCAGGGACCCGCGGGCTCGGGTTGCCGTTTCCCGCCCCACCCCGCGGCCGGCCTGGCTTCACTGGCGCCCTTTGGCCGCGACCACGGGAACCAGCGGTGAGGCCTGACCCAGCACCACGTTCTTCTTGCTTTGCTTTTTCCTAAGGATTTTGCTGCAAAGTCTCCTTCGGAACCCGAACTGCAAGCTGAGCGCCTGCCCAGATTCTCCCATGGGTATTTCACGTCGAAAGGACGCTGTTACATATGTATAACTTTCGCTTTAAAGTTTTTTTTTAACAAAACATATATATGCTGTTTATTTACTTATTTAAGAGACCGCCATGGTAGGTTTCTCTGTAGCTTGGGGAACTTGCTGTTTCTAAACATGCAGGCTGGTGGTGATGGGTTCTGTGTGGAGAAGCCAAACAATAAAACAACCTAGTGGGCAACCTTCTTAATTAAGGGAGCTGCTCTCAGATTCCTTTTCTTCTTATTATTATTAATATCATTCCCTTCACCAGGCATGCAGGGACCCTTGAGCAAATGGTCTCCGGAAGGTCTTACCTATATATCTTTTGCCTTCTTTGGTGCTTCCTGGTATATGTTTTAAACAACCTATGGTAGGTCTATAACCACCTCCCACGTCAAATTACACGTATGTGCATATATGTATGTACCTATACAAACATATGTATGTACCTATACAAACATATGTATGTATGCATACACGTGATATATTTAAGGCTAGAAATTGGCAACATGTGAGCGTCCTCTCTAAGGCAAGTCCCCGCATCCCCAGCACAGGTAATTATGGCTTGTCCACTTGACACTCGTTTACATGAAGTGTCAACAGCTTTCAGGAGCAATTTAGGAAGCCAAACTATGGGACTCAATAAGTGAGTCCTATTTTCTAAAAATGCAAAACTATCCTGACTCAGGCTCTGCAGCAAGAAAGGCTTTCTGTCTCCTTCAAGGCCCCCTCCAATACAAAAGCAGCAGGCACCCATGATCATGCTAGAGTGAGCATATACTGCATTTAGGATTGAGCTATTATTAAAATAAGACAAAAGATGATAGAAGAGGTTGTAAATAATTAGACTAACATCTTCTTGCTGCAGAATTTGGTTTTAATCAAATGAATGGTTTTTAACAAGAGGGATACTGAGATGGGGGAAAGGATGTAATCATGTCACATACTGAGGGTAAAACAAGGCTGTAGAAATAACTGGCATTTTAAAAACCTAATCTCCGAATTAAGCATAGAACAAGTCATCAAGGGCCTCATTGTCCTGGTAATGGCCTCGATTAAAACATAAAATATTTTTAGCATTTAATTTTTCCTCGTGCACATGCATGTATGCACCTATACATGAACAAATGCATGCATATACAACGCAAAAACATCTACCATCTTTGCACTAAGAAAATAAATGCTAGCCAGAGTCTCTAATTTTGTTCCTAGTGAAACAGATTGCATATTATAAAATTTGACATTGATCTTTAAA

Back to List