Details for gene: SSTR3


This gene encodes a member of the somatostatin receptor protein family. Somatostatins are peptide hormones that regulate diverse cellular functions such as neurotransmission, cell proliferation, and endocrine signaling as well as inhibiting the release of many hormones and other secretory proteins. Somatostatin has two active forms of 14 and 28 amino acids. The biological effects of somatostatins are mediated by a family of G-protein coupled somatostatin receptors that are expressed in a tissue-specific manner. Somatostatin receptors form homodimers and heterodimers with other members of the superfamily as well as with other G-protein coupled receptors and receptor tyrosine kinases. This protein is functionally coupled to adenylyl cyclase. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]


Symbol
SSTR3
Name
somatostatin receptor 3
Entrez ID
6753
Ensembl ID
ENSG00000278195    (more details)
KEGG ID
hsa:6753    (more details)
OMIM ID
182453
Uniprot ID
P32745  
GO ID
hsa:6753    (more details)
Chromosome
22
Strand
-1
Start
37204237
End
37212477
miRNA Interactions
hsa-miR-3926 (RPM: 0.0072) / hsa-miR-4685-5p (RPM: 0.0078) / hsa-miR-4753-5p (RPM: 0.097) / hsa-miR-766-3p (RPM: 5.2956) / hsa-miR-5685 (RPM: 0.0058) / hsa-miR-4726-3p (RPM: 0.0088) / hsa-miR-4690-3p (RPM: 0.1526) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-3918 (RPM: 0.7636) / hsa-miR-4776-5p (RPM: 0.1808) / hsa-miR-4780 (RPM: 0.2546) / hsa-miR-3194-5p (RPM: 0.013) / hsa-miR-4685-3p (RPM: 0.7634) / hsa-miR-3667-3p (RPM: 0.0008) / hsa-miR-4761-3p (RPM: 0.154) / hsa-miR-6720-5p (RPM: 0.0746) / hsa-miR-6749-3p (RPM: 0.0746) / hsa-miR-6849-3p (RPM: 0.0148) / hsa-miR-6734-3p (RPM: 0.014) / hsa-miR-6854-5p (RPM: 0.1492) / hsa-miR-6780b-3p (RPM: 0.0072) / hsa-miR-6764-5p (RPM: 0.111) / hsa-miR-6885-5p (RPM: 0.0796) / hsa-miR-328-5p (RPM: 0.3124) / hsa-miR-6792-3p (RPM: 0.0262) / hsa-miR-6837-5p (RPM: 0.057) / hsa-miR-6840-3p (RPM: 0.0218) / hsa-miR-6781-5p (RPM: 0.0224) / hsa-miR-6762-5p (RPM: 0.0064) / hsa-miR-6845-5p (RPM: 0.4416) / hsa-miR-6756-3p (RPM: 0.0192) / hsa-miR-6749-5p (RPM: 0.0316) /
Involved Diseases
uveal melanoma /
Involved Pathways
Neuroactive ligand-receptor interaction / Signal Transduction / Signaling by GPCR / Class A/1 (Rhodopsin-like receptors) / Peptide ligand-binding receptors / GPCR downstream signalling / G alpha (i) signalling events / GPCR ligand binding / Organelle biogenesis and maintenance / Cilium Assembly / Cargo trafficking to the periciliary membrane / BBSome-mediated cargo-targeting to cilium /
Sequence
ACTCCCTCCTTCACGGGCTCCATGTCACCATCTGTGGCACAGTCCCTCTCTGTCACTCTCCCTGCCACCCCCTCATTCTCCTTCCTCCCTCCTGCCTCTCTCTGCATCTCTCCCTCTCACCCGTGTCTCCTCTCCTCTCTTTCCTTCTCGTCTTCTCCCTGTCACGCATCTCTCATCACTCCCCCTCATTCTGCCTTTCCTCCTACTCACGGTCTCCTCTCCCTCTCCCTCTCTCTCTCTCCCCCTCCCTCTTTCTCTCTCTCTCTCTTTCTCCACCTCCTCCCGACCCCCTTTCCCCTCTATTTCTATTGGCTTCTGTGTCCCTTGCTCCCCTCTTCTCTTCCTCACCCTGGGAAGCTTCTCCCCCCTATCCTTGCCCCTGCCCCCCCAGGATGTGTCCTGGAGATGGGGGGTGACGTACCAGGCTCTGGTTGGGAAGTCAGGGCCGGAGACCAGATGGGAGAGGCTCTGTGGACAGCCGTGGCCGAGGGCCTGGGAGGGAACCTGAGCCCGCAAGCGGTCTAGAAGTGGGTGCCTTGTGGGGACCCTAGTTAGGAGTGCCCTGGGGGCACCTGGGGACTGGGCAGGGAGAGGGGACAGCAGAATGATAACCAGCCTGGCGGCAAGGAGGGAAGCCCTCACCCCATGGGCAGGTAAGGAGGCTGGGGCCCGGATGATGTCCCGAAGGGTGGGGTCCTGGAAGCCCATCCTCTGCCCAGGATGAACTTGGGAGGCTGGGGCTGGGGAGGCAGAGGGTGGGGACTCCCAGGGAGGCAGGAGGGAGGCCTTCCTGTGACCTCCCGGTCGGCTGCAGGGGCAGGGGCGTTAGTCTCAGAATCTCGTGCCATGATTCTAGGATCTCGGAATCACAGAATCGCAGGCTGTCAGGGCTGGAGGGAGCCAGATGTATCATGTCGTTGGCTTCCCCAGCTCACGTGGCAGCTCTCCTGAGCTCCCCCTCCATACCCGGCACTGTGCTTGGCACGCCTCCGTTTAATCTCTGCAAACAACCCTGGGAGGTGGGTCCGCTTGTCTTCCATATGACGAAACTGAGGTGCAGCGGGGAGAAGTGACTTGCCCGAGGTCACACAGCAATTTGGCATCATCGCTGTGCAGCAGAGCCCAAGCCCCCAGCGCTGGGCCTGTAGGGTGTGCTCCTGGGATCAGGCCCCAGGCCTGGGGTGCCAGTGAGTCAGTCGGCACTGGCAAGCATAAGCCAGGTGTCTTTGGGGGGAAGGCCGAAGCATGTAGAGGACAAGCAGAGAGCCAGGGGCCATCGCCCTGCACTATTCAGGACTGTCATGGCCTTTGATCCTTCTCAGCCTGAGGCCTTCAGAGGAGCCAGTGTGGCCAGGAGGTACTGATGGTTTAGAAGTAGATAGAACTGGGTTCGAATTCTGGCTTCCCACTCTCCAGCTGGGTGACCCTTTGCAGCTTACTCAACCTCTCTGAGCCTCAACTTCTTCCTCTCTAAAAACTCTCCCTCTTGGGCTTCTTGAGGATCTCATGATGTGAGTCTGAGGCTTCCATCCGGGGACAATGTCCCACCTTGGAGCTCTCCTTGTTGAACGGCTTGGCTGTTCACATTTATGGCTGTTCTGGGTGATGTCCTAGGTTCTGGGGTTAAGAAATAAATCATTCAGGGCCCCTGCCTTCAAGAGCCAGTGTTCTAGCGGGTGGGAGATGGGCAAATGGAGAATGATTGGGGTGCCTGGCCTCCCTGAACTGTTAGGGCTGTGCGGCTCAGGACAGCCACTCACCCTCTCTGTGCTGTCTCCTCCTGAACAGTCCTCCAAGGAGTCCGCCCCCAGCTTTCAGGCAAGCTTGTGCCAAAGATAAACCAGACAGGGAGGAAAAGTCCCTCCTTCTCAAGGATGAACTAGATCATGCACAGGATTCCAGCTCTAAAGAAAAGACGGCACCTCAATTGCAGGTCTGGCTTACGTGCGTGGAAAGCTGTAATTTCCCTGCTTCTGCTGCCTGGGCCCCTCAAACTTTGACAGGGAAGACCGGCTGAGATAAGGGTGGAGACAGGGTTTTCCAGGAGGGGGCCAGGGGTTCTGGGAGGGGCGACTGCATGCCCTGGTACAAAGGAGGGTCTGGCTAGGCACGCCGTGTTCCTGCCAGGACCATGTGTGTGTCAGCGCATGCGCTTGTGGGTGCACAGACATGTGCTGGGCAGGCGTGGGGGTGGGGCAACCTCAGAGCTTACCCCCAGCGGGCTACCCCAGGGGCATATGTCCCTGAAGCCTGGAAATTAGGCCTGCCCAGCTCCTTGCTTCTCTCAGGAGCCTGGTGCTCCCCTCCCTCATCTAGCCCTGGCTTGTGATTGGCTGACCAGCAGGGATGCTATAAAGAGGATCTGTGCACAGCACAGGGCAGCAAGGTGGATGGTGACGCGGGTCCCCTACCAGGGAGGCAGGACTCTAAGGTTCCAGGTTGCACAATTCCAGGTCTAAGAAGGACTCATTCTAGCATTCTGGAATTCTAACATTCTCTGATTCAAGGATACTGAGTCTAAAATCCTATGGCTGTAAGATTCTCTGCCTGTTCTAAGAATTCAAAATTCTATTTTTAGATCTCTAAGGTCCATTAGGCTTTGAGTCCATGATCCTCATAGCTCAAAGCCCTGGGGGCAACTGGGAAAGCGGATGCCAGCTGGGCACTCAGGTGGGTGCCTTCCCAGGCCTGGCTTCAGTTTGCCAGCCTGTGGAATGGGCGTAGAGGTGGTCACTACAGATCTTTCCAGATTTGCCCCTTCCTAGCTGTGACCAGAACATGTGACCTCACGTTTGCTCCCCATCTGTGCAGTGGGGATGACAGTAGTGCCTCCCTCGTAGGACATCATAGGATACTGCAGCTCACCAGCTTAGCCTGGCACCTGGCACAGTCAGGGCTCAGTGATGAGCAGCTGGCAGCACTGTTAGGATCCTCTAGCCCACTGTCCAGGTGCCCCTCCCTTAGTGCTGCTGTCCCAGGCTCAGGAGACCTGATGAAGGGTTGGGGAGAAGGATGGGTTGAGGACAGGTTAGGGGATGACCCAGGCTCAGAATCCTTCTCTTCTCCCAGCCCCAAGAACAGGGAGGAGATGCTCTGAACCCAGCCAGCTGGAGAAGCCACGGCCTAGGGGTTCCTTGCTACCCTTGGCTTCACCCAGCCTGGCACTCTGAGCCCGCTGCAGCCCCAGGTCCTTGGGGCAGGGGTAGCCAGGCGTGCTCAGAGGCGTTTGTTTGGATTTGGGGTGCCTTCCCTTCCCAGGAGCTTTGCACATCAACAGTGACATCCATATAGGGCAGTGCGGACCACAGCTCCCATTGGAGGGAGGAAGTGCAGGCCCAGTGTCAGGGATATTAGAAGAAGGGCTTCTCCTCTGAGAGATTTATCTTCCCTTCAGGGTTTTCTGCAGGGAGAATCCAAGGACAGCCAGGAGCCAGGGGATTGGGGGATCATTAGGAAGAGGGGGTGCAGTGGGTGGTCCAGACCCCAGAGGAGGCTCCTGCATCCAGCCTGGCTCTGCCTGGGCCTCCTCCTGAGCGTGGCTTTCCTCAGTGGGGCCTGACATTCCCCCTTGGCACTGGGCTTGGTCCACTGAAGGCTTCTCTGGTTCATTTGATGCCTGACACTGAGGCAGAGCTCGTGCCTGTGCGGAAGTGATGGGGCAGAAAGCAATGGGGAGGGTCCAAAGCTGGCTGGAGACTCCACAGGGGAGGGGATCAGAGTCTCGCAGGGGAGCCCAGAGGAGCCCCAGCTTCTTCTGCGCAGGCATGGGATGAGAAAGACACTAAGAAAGCACCTGGAGTGCGGGGGGGCTCTTGCTTATGCTGCAAATCCCTTCTGAAAATGTCCCCTTTTCCAGGCAGCTGGCCCCTCCAGCCAGGGGGAGGGACTACTCTTGGATAGCATCTGCTAAGTGAATTGTAAAGTTCTCCAACCCCAGCCGGCCTCTGGGGAGAAGGGGCCTCAGCCACCTGCCCCCCAGGTTCACAGCCAACCTTCCTGGGCAGGGCCTTTGGGAGGGGCACAGTGGGATGGCCCAGGCTGAGGGGGCACCTAAGGACTCTGACTCCCAGGGGAGGGGACACCCCAAGCCTGTGGTTCTTAACTCCATTTGGAACCTGAAGAATCTGATAACAGATCTGACATTAACCTTCACCTGGAGTTTAGGGCGTTCATGGATCCTCTGAAGTTCATCTAGGGAGCAGGTTTCCAGGTGAAGGTCCTGTGATATGAAGCAGTGTTTTTCAGATGTGAGGGCGAGACCTGTTGGTGGCAATGCAACCCACTTCACAGGGCCCTGCCAGCTGGGGCCTCACATGTAGAAAGGAAGGGCAGGTATTTGTTGGTGAAACAGTATGACTTCATGCCACACACCACACCCTCACTCCACGATGGAGAATGATCACCTCACCTCCCTGAGCCTCAGTTTCCTCATCTGAGAAAAGGGGATAACACGACTCAGCCTTGCGGGGCTGTGCGGGGTGAATGAGATGGTGCGTGCTAAGCACCTCCCATCTTCTGAAATCTCTCAGACGATGGGAGGATGGGCGTGCAGCAGGTCCCCAGGTTCGGCATGATGGGAGGGGGCAGCACAGAGAAAGCCATTCTCTGCTGTGACCGAGCTGTTTTTCCTTCCCCCAGGCAAATAGCTGACTGCTGACCACCCTCCCCTCAGCCATGGACATGCTTCATCCATCATCGGTGTCCACGACCTCAGAACCTGAGAATGCCTCCTCGGCCTGGCCCCCAGATGCCACCCTGGGCAACGTGTCGGCGGGCCCAAGCCCGGCAGGGCTGGCCGTCAGTGGCGTTCTGATCCCCCTGGTCTACCTGGTGGTGTGCGTGGTGGGCCTGCTGGGTAACTCGCTGGTCATCTATGTGGTCCTGCGGCACACGGCCAGCCCTTCAGTCACCAACGTCTACATCCTCAACCTGGCGCTGGCCGACGAGCTCTTCATGCTGGGGCTGCCCTTCCTGGCCGCCCAGAACGCCCTGTCCTACTGGCCCTTCGGCTCCCTCATGTGCCGCCTGGTCATGGCGGTGGATGGCATCAACCAGTTCACCAGCATATTCTGCCTGACTGTCATGAGCGTGGACCGCTACCTGGCCGTGGTACATCCCACCCGCTCGGCCCGCTGGCGCACAGCTCCGGTGGCCCGCACGGTCAGCGCGGCTGTGTGGGTGGCCTCAGCCGTGGTGGTGCTGCCCGTGGTGGTCTTCTCGGGAGTGCCCCGCGGCATGAGCACCTGCCACATGCAGTGGCCCGAGCCGGCGGCGGCCTGGCGAGCCGGCTTCATCATCTACACGGCCGCACTGGGCTTCTTCGGGCCGCTGCTGGTCATCTGCCTCTGCTACCTGCTCATCGTGGTGAAGGTGCGCTCAGCTGGGCGCCGGGTGTGGGCACCCTCGTGCCAGCGGCGGCGGCGCTCCGAACGCAGGGTCACGCGCATGGTGGTGGCCGTGGTGGCGCTCTTCGTGCTCTGCTGGATGCCCTTCTACGTGCTCAACATCGTCAACGTGGTGTGCCCACTGCCCGAGGAGCCTGCCTTCTTTGGGCTCTACTTCCTGGTGGTGGCGCTGCCCTATGCCAACAGCTGTGCCAACCCCATCCTTTATGGCTTCCTCTCCTACCGCTTCAAGCAGGGCTTCCGCAGGGTCCTGCTGCGGCCCTCCCGCCGTGTGCGCAGCCAGGAGCCCACTGTGGGGCCCCCGGAGAAGACTGAGGAGGAGGATGAGGAGGAGGAGGATGGGGAGGAGAGCAGGGAGGGGGGCAAGGGGAAGGAGATGAACGGCCGGGTCAGCCAGATCACGCAGCCTGGCACCAGCGGGCAGGAGCGGCCGCCCAGCAGAGTGGCCAGCAAGGAGCAGCAGCTCCTACCCCAAGAGGCTTCCACTGGGGAGAAGTCCAGCACGATGCGCATCAGCTACCTGTAGGGGCCTGGGGAAAGCCAGGATGGCCCGAGGAAGAGGCAGAAGCCGTGGGTGTGCCTAGGGCCTACTTCCCAAGGTGCCACAGGCCCATGATGGGATGTTGAGGGGCCTGGACTTTGATGCTATTGCTGCCAGGTCTTGCTGTGTGACCTTGGGTAGGTTGCTTCTACTCTCTGGGCCTTGTTTTCTCCTCTGTGACTCAGGGATAGGAGTCATCAGCCTGGATGAGCTATGTCAGATGAGAGGTTTGGAGGGCACTGTTGCTGGGCTGACCTGGCTGAGCAGGCAAAAGGTGGGTGCAGACTGGCCTCCCCCCAGGGATGGAGTGTCTTGGGGCATCAACTAGAATCTTGGCCCTCAGAGGGATAAACCAAGGCCAGGATTTCTTGGGCTCAGAGTCAGGAACACAGGAGCTGCTGGGGGCTGGGCTGGAAACCTAAACAGAAGAAAGCCTAACCCGGTGGGAGGAGTGGGGCAGAAATGGTCAGGCCCCAGATCAGCTCCCTCCCCTCGACTGTGAGGCCTTGGACCAGCTCTGCTCCTCTCTAGGCCTCAGGCTTCACCTGGGTAAAACCCAACAACCTCTACACCCTTTTGGCCCAGGCAGTCAATGCTGGAGGTCCTGTGCTCCTGGACGGGAAGAGCAGGTGAATTTCCTGCTCATGGAAGCGAATGAAGTCCAGCTTCAGGGTCTCTCACTGCCTGGGCTTTTGCAAGGCCCTGCATCTACTTTTGTACTTGTCATTTTGTATTCGTTTTCTTAAAGAGGGACCTCGAACTGCATAAGCTTAGGCCACCCAAAGCCTGGCTCTGCCCCTGCTGAGGTCAGCCACCCAATCCCCAAGGAAGCTCATGTTGGGTCTTATGGCTGGAGTAGGGGCCCCCGGGGGTTCCCAGGTCTTTTGAGGGCTTCCAGGCACCTCCTTGTAGGAAGGGCCATCCCTGTTCCTCTCCTTGTGACCCATATTCTCCCTTCCTGGAGACCGAGACAGGGACCCAGCCCATGAGGACTGGCATGGAAAGGCAGAGTGTCTGAAGAGCGCTGTGAGGAGAAGGAAGAGGAAGGGAGAAGAGGAAGAGGAAGGAGAAGGAAGAGGAAGACAAGGGGGAAAGGGGAGGATGAGGAGGGGGAAGGAGAAGTACAGATCTGTTTCCTGGAGCCGTCTTTGGCCCCCCTGGGCTGAGCTCAGTGGTAGCATCTGTGAACCTGAGTTGCCGACAACAGCCCCACCCAACCAGTACTGAGGGAAGGACACGATCAGGGTGGAACAGCCAGGGTGCAATGGCAAATGCACAGAGTACAGACAGGCACAGGGCCTGCGTCCCTGAGGGGCCTCAGAGTGCTGCCAAGAGGGCTCAGGCCTTAATAAAGCCCTAGGGTGGAGCTGGCTACCAGGGACATTGGGAGGACTGGGGAGCTCCCTCCCCATGCTCTATCATCCTGGAGACTACAGGTCGGGAGGCCCAGGGAAGACAAGAAGAGGCTGAAGTGGGACTGTGGAGGGGGACCATGGGGAGCAGCCACCATCCAAGGCTGGGCCTAGACTCCCTCCCAGAGATGGTCCCTCAGAGCTGTGGTGAGGCTGGCCCTGGGAGGGTGAGACCCCCGGTGAAATCCTTCCGCTTCCCCACCCCTTGCAGAGGGCAGGGGTCCTCAGGGAAAGCACAGGAACCAGACTTTTGGAGACTTGGATCTTCAGCACACCTCAGGGTCCTGGGCTGGCATTGGCCTTCCGGGCCTCAATTTCCCCATCAACAAATGGAGATGAATCCCAGCTTGGCTGCCTCCTGGGATCTAACGAGAAAATGAGTCATGTGAGGTAACTTCCAGGCTCACTGCAATGGGTACGGTGGGGTGTATCAGATTATAAAGTGGGGGTGCCCTCCTCACCCCCAGGCTTGGCCTATACCCCCCTCTCCATCAAGTGGCCTCTCTGTGTCTGTCCTTTGGGGTGAGGACACTGTAGGCCATGAGAAATGGGCAGTTGGGGGGTCAGAGGCCAAGGGTTAGGGAGGCAGGGCTTGGGGAGAGTGTGGGACCATCAGAAGAGAAGGAAGTTTACAAAACCACATTTTGTGTGGAGATGGAGGCTGGAGGCCCGGCCCTGGGACTTGGTCTGGGGTTTCTTGAGGAAGATCTGAGGGTCCAAGGGAGGAAGGATGCCCTGGCCTTCTGGCCTTCTCTGGCTGATCCTGCCTTCTTGCTGCCTAGGACAGGAGAGTAATGTCCTAGAATGGTCCCTGGGAGGCCAGTTAGGAAACCCTTTGCTGCTTCTGTCTCTAGCTCTTGTCAATAAAGACGGTGACACCTGA

Back to List